Mmlv reverse transcriptase

According to the manufacturer’s protocol, total RNA was extracted from homogenized cell samples with TRIzol reagent (Takara Bio, Otsu, Japan). For each sample, 6 μg of RNA from cell lines was used for reverse transcription with MMLV reverse transcriptase (Genepharma, Suzhou, China). The primer sequences were as follows: miR-543 forward: 5′- CAGTGCTAAAACATTCGCGG -3′ and reverse: 5′- TATGGTTGTTCACGACTCCTTCAC -3′; and U6 snRNA forward: 5′- CGCTTCGGCAGCACATATAC-3′, and reverse: 5′- TTCACGAATTTGCGTGTCATC-3′. Each PCR was conducted at 95˚C for 3 min, followed by 45 cycles at 95°C for 12 s and 62°C for 50 s. The expression of miR-543 was determined using Light Cycler 2.0 with the Light Cycler kit (Takara, Japan), and the U6 gene was used as the internal control for miR-543.

MiRNAs shown to have significantly different expression by the miRCURY LNA Array were further validated by real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) in plasma samples from all participants in each group. The qRT-PCR analysis was also performed with thyroid tissue samples and plasma samples of PTC patients 4 weeks after thyroidectomy to observe the expression of the dysregulated circulating miRNAs in thyroid tissues and the alteration in the plasma after thyroidectomy.
Reverse transcription was performed in a 20 μl reaction system containing 1.5 μg of total RNA, 1.2 μl miRNA-RT primers (1 μM), 10 nmol dNTP Mix, and 0.2 μl MMLV reverse transcriptase (GenePharma). The qRT-PCR analysis of miRNAs was performed using SYBR Green microRNA assays according to the manufacturer's protocol. Primers (5′-3′) used for the detection of the selected miRNAs are shown in Table 5. The expression of miRNAs relative to miR-16 was determined using ΔΔCt-based fold-change calculations.