Total RNA was isolated from mIMCD3 (WT and Pkd1KO) cells and mouse kidneys with RNeasy Mini Kit (Qiangen, Germantown, MD). SuperScript first strand system for RT-PCR (Invitrogen, Carlsbad, CA) was used to generate complementary DNA. For quantitative PCR, we used iQ SYBR Green Supermix (Bio-Rad, Hercules, CA). Following primers were used for PC2 (GAT GCC ATC TCA GAG AGT CTC and CT CAT CTG TTG ATG CTC ACG), and GAPDH (AGG TCG GTG TGA ACG GAT TTG and TGT AGA CCA TGT AGT TGA GGT CA). PC2 and GAPDH primers were designed based on Mus musculus mRNA sequence.
Superscript first strand system for rt pcr
Manufactured by Thermo Fisher Scientific
Sourced in United States
The SuperScript First-Strand System for RT-PCR is a kit used for the synthesis of first-strand cDNA from RNA templates. It provides the necessary components for the reverse transcription step of the reverse transcription-polymerase chain reaction (RT-PCR) process.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (2 mentions)
Iq sybr green supermix, by Bio-Rad (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Superscript 2 rt, by Thermo Fisher Scientific (1 mentions)
Dreamtaq dna polymerase, by Thermo Fisher Scientific (1 mentions)
Kapa sybr fast qpcr kit, by Roche (1 mentions)
3130xl sequencer, by Thermo Fisher Scientific (1 mentions)
Precellys 24, by Qiagen (1 mentions)
Nanodrop 2000c spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Rnase free dnase set, by Qiagen (1 mentions)
5 protocols using superscript first strand system for rt pcr
1
Quantification of Pkd1 Expression in mIMCD3 Cells
2
Quantifying Liver Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from perfused whole liver using TRIzol reagent (Life Technologies, CA, USA) according to the manufacturer’s instructions. First-strand cDNA synthesis was performed using total RNA primed with oligo (dT) and SuperScript II RT (SuperScript First-Strand System for RT-PCR, Invitrogen), following the manufacturer’s recommendations. The PCR protocol for CPT1A consisted of 40 cycles of 90°C for 1 min, 60°C for 1 min and 72°C for 1 min. The PCR protocol for GAPDH consisted of 35 cycles of 94°C for 1 min, 57°C for 1 min and 72°C for 1 min. PCR was performed using CPT1A primers GAACTTGCCCATGTCCTTGT (right) and CCAGGCTACAGTGGGACATT (left) and GAPDH primers ATACCAGGAA ATGAGCTTGACAAAGT (right) and CCAGGTTGTCTCCTGGGACT (left) (GenBank). The PCR products were visualized on 6% polyacrylamide gel using silver staining. Images were analyzed using the ImageMaster 2D Elite program.
3
Intracellular Delivery of IVT-mRNA via PTD
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The successful intracellular delivery of the IVT-mRNA, through its conjugation to the PTD, was evaluated via total RNA extraction from transduced cells, using Tri-Sure, as described above. Two-step RT-PCR was performed, with the SuperScript First-Strand System for RT-PCR (cDNA synthesis; Invitrogen Life Technologies, USA) and the DreamTaq DNA Polymerase (Thermo Fisher Scientific, USA) for the PCR reaction using specific primers.
For the IVT-mRNA intracellular detection via qPCR, the primers FAMU2SCO/BAMU2SCO (for SCO2) and F-beta2/R-beta2 (for β-globin) were designed, as previously described. The delivery levels of IVT-mRNA were quantified by two-step qPCR analysis with the KAPA SYBR FAST qPCR Kit (KK4602; Kapa Biosystems), according to the manufacturer’s instructions, and all reactions were run in duplicate. In this study, β-actin mRNA was chosen as the endogenous control. The relative levels of the IVT-mRNAs were calculated with the 2[-Delta Delta C(t)] (2−ΔΔCt) method,61 (link) and the differences in IVT-mRNA intracellular amounts between the treated and control cells were expressed as FD changes.
For the IVT-mRNA intracellular detection via qPCR, the primers FAMU2SCO/BAMU2SCO (for SCO2) and F-beta2/R-beta2 (for β-globin) were designed, as previously described. The delivery levels of IVT-mRNA were quantified by two-step qPCR analysis with the KAPA SYBR FAST qPCR Kit (KK4602; Kapa Biosystems), according to the manufacturer’s instructions, and all reactions were run in duplicate. In this study, β-actin mRNA was chosen as the endogenous control. The relative levels of the IVT-mRNAs were calculated with the 2[-Delta Delta C(t)] (2−ΔΔCt) method,61 (link) and the differences in IVT-mRNA intracellular amounts between the treated and control cells were expressed as FD changes.
4
Transcriptional Analysis of Splice Site Variant
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For transcriptional analysis of the novel splice site variant, frozen tumor tissues were obtained from the carrier and from a sporadic breast tumor that was negative for mutations in the BRCA1 gene, which was used as a control sample. RNA samples were purified using the Precellys 24® equipment (Carlsbad, California, USA), followed by total RNA extraction using an RNeasy Mini kit (Qiagen, Venlo, The Netherlands). The first strand cDNA was synthesized from 2 μg of total RNA using a random hexamer primer with the Superscript first strand system for RT-PCR (Life Technologies, Foster City, USA). RT-PCR fragments of the index patient and the control sample were both obtained according to standard PCR protocols using primers adjacent to the exon involved in the splice site mutation. All RT-PCR products were inserted into the T/A plasmid vector pTZ57R/T using the InsT/Aclone PCR Product Cloning Kit (Thermo Fisher Scientific, USA), and the ligated plasmid was used for transformation in DH10B E. coli cells via electroporation (2.5 KV, 25 μ FD, 200 OHMS), followed by single-colony sequencing on the ABI 3130xl sequencer using M13 primers.
5
RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA was extracted using RNeasy® Mini Kit (Qiagen, Courtaboeuf, France) and treated with RNase-Free DNase Set (Qiagen) directly on RNeasy columns to eliminate genomic DNA according to the manufacturer’s instructions. RNA quality and quantity was determined using a NanoDrop® 2000c Spectrophotometer (Thermoscientific, Courtaboeuf, France). Samples were stored at −80 °C until further processing. Approximately 500 ng total RNA was retrotranscribed with the Superscript® First Strand System for RT-PCR (Life Technologies, Courtaboeuf, France) in combination with Oligo(dT) 12–18 primers and RNase-OUT following the manufacturer’s instructions. One sample was treated in absence of reverse transcriptase to validate the absence of genomic DNA. Three independent reverse transcriptions steps were conducted for each sample. All cDNA samples were stored at –20 °C until further processing.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!