Two different siRNA duplexes targeting Rnd3 were used: Rnd3 #1 (CUACAGUGUUUGAGAAUUAUU) and Rnd3 #2 (GCGGACAGAUGUUAGUACAUU) (Dharmacon). The nontargeting siControl#1 was also used (Dharmacon). The siRNAs were transfected into cells using Oligofectamine (Invitrogen) at a final concentration of 25 nM. After transfection, cells were cultured for an additional 72 h in complete medium, and then they were processed for further analysis.
Sicontrol 1
Manufactured by Horizon Discovery
The SiControl#1 is a lab equipment product designed for precise temperature control. It features advanced thermal regulation capabilities to maintain consistent and accurate temperatures within a defined range. The SiControl#1 is intended for use in various scientific and research applications that require precise temperature management.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using sicontrol 1
1
siRNA Knockdown of Rnd3 in Cells
2
Targeted AXIN1 and APC Silencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The siRNA‐targeting reagents were purchased from Dharmacon, as a SMARTpool of four distinct siRNA species targeting different sequences of the AXIN1 transcript (L‐009625‐00‐0005) and the APC transcript (L‐003869‐00‐0005). Cell lines were grown and transfected with SMARTpool siRNAs using RNAiMAX (Invitrogen) transfection reagent, following manufacturer's instructions. Each experiment included the following controls: mock control (transfection lipid only), siControl1 (Dharmacon), AllStars (Qiagen) as negative control, and polo‐like kinase 1 (Dharmacon), which served as positive control (Brough et al, 2011 ).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!