Nbt bcip

Manufactured by Vector Laboratories

Sourced in United States, Germany

NBT/BCIP is a chromogenic substrate used for the detection of alkaline phosphatase (AP) activity in various applications, such as Western blotting, immunohistochemistry, and in situ hybridization. When AP-conjugated detection systems are used, the substrate is converted into a colored precipitate at the site of the AP activity, allowing for visual identification of the target.

Automatically generated - may contain errors

Lab products found in correlation

Nuclear fast red, by Vector Laboratories (3 mentions) Dig rna labeling kit, by Roche (3 mentions) Axio imager, by Zeiss (2 mentions) Lna microrna ish mir 122 optimization kit, by Qiagen (2 mentions) Sheep anti digoxigenin ap, by Roche (2 mentions) Nbp2 14833, by Novus Biologicals (2 mentions) T3 or t7 polymerase, by Thermo Fisher Scientific (2 mentions) Bm purple, by Roche (1 mentions) Anti dig ap antibody, by Roche (1 mentions) Biotinylated goat anti rabbit igg secondary antibody, by Vector Laboratories (1 mentions) Vectamount aq mounting medium, by Vector Laboratories (1 mentions) Biorevo, by Keyence (1 mentions) Multiscreen plate, by Merck Group (1 mentions) 5 bromo 4 chloro 3 indolyl phosphate nitro blue tetrazolium, by Vector Laboratories (1 mentions) Acetic anhydride, by Merck Group (1 mentions) Dm irb microscope, by Leica (1 mentions) Roti histol, by Carl Roth (1 mentions) Mircury lna microrna detection kit, by Qiagen (1 mentions) Proteinase k, by Qiagen (1 mentions) Casein solution, by Vector Laboratories (1 mentions)

14 protocols using nbt bcip

Comprehensive Retinal Cell Profiling

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The following digoxigenin (DIG)-labelled riboprobes were used for colorimetric in situ hybridisations: neurod (Blader et al., 1997 (link)), crx (Liu et al., 2001 (link)), rx1, rx2 (Chuang et al., 1999 (link)), nrl (Nelson et al., 2008 (link)), nr2e3 (Chen et al., 2005 (link)), rod α-transducin (gnat1) and cone α-transducin (gnat2).
WISH on 6 dpf larvae was performed according to standard protocols (Thisse and Thisse, 2008 (link)). BM purple (Roche) was used as substrate.
Adult eyes or 6 dpf larvae were harvested and 10 µm cryosections prepared as described (Laranjeiro et al., 2013 (link)). In situ hybridisation on sections was performed as previously described (Schaeren-Wiemers and Gerfin-Moser, 1993 (link)) with the following modifications: blocking was performed with 10% goat serum in buffer B1; incubation with anti-DIG-AP antibody (Roche, 11093274910; 1:5000) was performed overnight at 4°C; to perform the colour reaction, BCIP/NBT (Vector Laboratories) in buffer B3/0.1% Tween 20 was used. All sections were stained with DAPI to aid identification of the retinal cell layers.

Laranjeiro R, & Whitmore D. (2014). Transcription factors involved in retinogenesis are co-opted by the circadian clock following photoreceptor differentiation. Development (Cambridge, England), 141(13), 2644-2656.

+ Open protocol

+ Expand

Rtl1 Antigen Retrieval and Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols

For antigen retrieval, the sections were boiled in Immunosaver (1:200; Nissin EM) at 98°C for 40 min and then immersed (dehydrated) in ice-cold methanol at −30°C overnight. After being air dried, the sections were blocked with 10% goat serum, 1% bovine serum albumin (BSA: Sigma Aldrich) and 0.1% Triton-X 100 (WAKO) in PBS at room temperature for 1 h.
For the immunohistochemistry analysis, anti-Rtl1 antibody (1:200) was used as the primary antibody and was prepared in 1% BSA and 0.1% Triton-X 100 in PBS at 4°C overnight (for more than 20 h). This primary reaction was developed with a biotinylated goat anti-rabbit IgG secondary antibody (1:200; Vector Laboratories) for 2.5 h, then incubated with alkaline phosphatase (AP) complex (1:200; Vector Laboratories) for 1 h. The histochemical detection of the alkaline phosphatase activity was performed with BCIP/NBT (Vector Laboratories) in 100 mM Tris-HCl at pH 9.8 and mounted with VectaMount AQ Mounting Medium (Vector Laboratories). The images were captured using BIOREVO (Keyence).

Kitazawa M., Hayashi S., Imamura M., Takeda S., Oishi Y., Kaneko-Ishino T, & Ishino F. (2020). Deficiency and overexpression of Rtl1 in the mouse cause distinct muscle abnormalities related to Temple and Kagami-Ogata syndromes. Development (Cambridge, England), 147(21), dev185918.

+ Open protocol

+ Expand

Quantification of PiCV-specific IgY-SBC

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The MultiScreen plates (Merck Millipore, USA) were coated with 100μL/ well of a PBS solution of PiCV rCP (conc. 20μg/ 1 mL). The samples were standardized to 1.5 x 10⁵ mononuclear cells and seeded in triplicate directly to the wells of previously coated with PiCV rCP plates. After incubation with Iscove’s modified Dulbecos medium (IMDM; Sigma Aldrich, Germany), the plates were rinsed and incubated overnight with biotinylated rabbit anti-pigeon IgY (Antibodies-online, USA). After rinsing, 100 μL of streptavidin, alkaline phosphatase (S-AP) (Vector Laboratories, USA) dissolved 1:500 in PBS (Sigma Aldrich, Germany) were added to each well. Enzymatic reaction was performed with an alkaline phosphatase substrate (BCIP/NBT; Vector Laboratories, USA) and stopped with distilled water. All details concerning rinsing and incubation steps were described in our previous study [5 (link)]. Counting of spot forming units (SFU) corresponding to anti-PiCV rCP IgY-SBC was performed with an Eli.Scan plate scanner and Eli.Analyse software (A-EL-VIS, Germany). Data were expressed as the mean absolute number of SFU +/- standard deviation per 1 x 10⁶ of mononuclear cells in each group in each day of sampling.

Stenzel T., Dziewulska D., Śmiałek M., Tykałowski B., Kowalczyk J, & Koncicki A. (2019). Comparison of the immune response to vaccination with pigeon circovirus recombinant capsid protein (PiCV rCP) in pigeons uninfected and subclinically infected with PiCV. PLoS ONE, 14(6), e0219175.

+ Open protocol

+ Expand

Whole-mount Embryo Analysis and Histological Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols

For whole-mount embryo analysis, embryos were fixed with 4% paraformaldehyde (PFA). β-Galactosidase activity in the Rosa26R3 crosses was detected after incubation with X-gal (5-bromo-4-chloro-3-indolyl-b-d-galactopyranoside; Invitrogen). Alkaline phosphatase activity in Z/AP mice was detected using BCIP/NBT (5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium; Vector Laboratories) staining according to manufacturer’s protocol. Cre expression in the uterus was evaluated using the Gt (ROSA)26R3^Sortm1Sor/J, Z/AP, and mT/mG mouse reporter lines. Frozen sections were fixed with 4% PFA and then stained with BCIP/NBT or by immunofluorescent analysis for mT or mG. Immunofluorescence analysis was performed on paraffin-embedded samples as previously described (17 (link)).
The effects of Lifr deficiency on glial cells of the central nervous system (CNS) and osteoclasts in bone were histologically characterized and by hematoxylin and eosin (H&E) staining with images being recorded on a Zeiss Axioimager. Paraffin-embedded thin sections of spinal cords (5 μm) were stained with an antibody against GFAP to identify glial cells and counterstained with Nissl stain. The osteoclasts in the long bones were identified by their unique morphology and size after H&E staining, performed using standard histological procedures.

Cheng J., Rosario G., Cohen T.V., Hu J, & Stewart C.L. (2017). Tissue-Specific Ablation of the LIF Receptor in the Murine Uterine Epithelium Results in Implantation Failure. Endocrinology, 158(6), 1916-1928.

+ Open protocol

+ Expand

In Situ Hybridization Methodology for Tissue Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

In situ hybridization was performed as previously described (24 (link)). Briefly, 10 μm tissue sections were fixed in 4% paraformaldehyde, permeabilized with pepsin, acetylated in 0.25% acetic anhydride (Sigma, St. Louis, MO) in 0.1M triethanolamine, equilibrated in 5× SSC and prehybridized (mRNA in situ hybridization solution; DAKO Corp., Carpinteria, CA) with 250 μg/ml Torula yeast tRNA, 70°C, 2 hr. Sections were hybridized with 30 ng/ml riboprobe, 70°C, 20 hr, in a humidified container. Hybridized sections were stringently washed, blocked with 10% normal rabbit serum and incubated with HRP-conjugated anti-digoxigenin or anti-FITC Fab (DAKO), 1/5000, 4°C, 18 hr. Sections were washed in TBST, incubated in biotinyl tyramide (DAKO Genpoint), washed in TBST and incubated with alkaline phosphatase-conjugated anti-biotin Fab (DAKO), 1/3000, 25°C, 2 hr. Sections were washed in TBST, developed with BCIP/NBT (Vector Labs, Burlingame, CA) and photographed with a Leica DM IRB microscope (Leica Microsystems) using a MagnaFire 2.1C digital camera system (Optronics).

Zhai S.K., Volgina V.V., Sethupathi P., Knight K.L, & Lanning D.K. (2014). Chemokine-mediated B cell trafficking during early rabbit GALT development. Journal of immunology (Baltimore, Md. : 1950), 193(12), 5951-5959.

+ Open protocol

+ Expand

Detection of miR135b-5p in Tissue Sections

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The detection of miR135b-5p expression in tissue sections was performed using the miRCURY LNA microRNA Detection Kit (QIAGEN, Hilden, Germany) as described.³² (link) Staining was performed on formalin-fixed, paraffin-embedded patient tissues. Briefly, the sections were dewaxed in Roti-Histol (Carl Roth, Karlsruhe, Germany, rehydrated in 2-propanol, treated with proteinase K (15 mg/mL; QIAGEN, Hilden, Germany) and air dried. Hybridization was performed for 2 h at 52°C, using a miR-135b-5p-specific sequence; the sequence of the digoxigenin-labeled locked nucleic acid (LNA) detection probe was 5′- TCACATAGGAATGAAAAGCCA-3′. A scrambled miRNA probe was used as a negative control. After stringent washes, the bound LNA probes were detected with alkaline phosphatase-conjugated digoxigenin Ab (Roche Diagnostics, Mannheim, Germany) and nitroblue tetrazolium/5-bromo-4-chloro-3'-indolyphosphate p-toluidine (NBT/BCIP; Vector Laboratories, Burlingame, CA, USA) as the substrate. Nuclear Fast Red (Vector Laboratories, Burlingame, CA, USA) was used for nuclear staining. The sections were mounted using Roti-Mount FluorCare.

Yin L., Xiao X., Georgikou C., Luo Y., Liu L., Gladkich J., Gross W, & Herr I. (2019). Sulforaphane Induces miR135b-5p and Its Target Gene, RASAL2, thereby Inhibiting the Progression of Pancreatic Cancer. Molecular Therapy Oncolytics, 14, 74-81.

+ Open protocol

+ Expand

Whole-Mount In Situ Hybridization of Zebrafish Shank3 Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Larvae were dechorionated and placed in a mixture of fish facility system water and 0.003 % phenylthiourea at 24 hpf. Embryos were fixed and processed for WISH. Table S2 in the Supplementary Material lists the WISH primers that were used to amplify and synthesize RNA probes. The PCR products were then cloned into a pGEM-T Easy vector. Sense and antisense RNA probes were individually transcribed using linearized constructs with T7 or Sp6 polymerase (Ambion, USA) in the presence of digoxigenin (DIG, Roche, Germany)-labeled UTP using a DIG-RNA Labeling Kit (Roche, Germany). The resulting DIG-labeled antisense probes were used to label the shank3a and shank3b genes respectively, and the sense probes were used as negative controls. WISH (approximately 40 eggs/clutch) was performed as described previously (Thisse and Thisse, 2008 (link)) using 5-nitro-blue tetrazoliumchloride and bromo-4-chloro-3′-indolyl phosphate p-toluidine salt (NBT/BCIP, Vector Laboratories) as substrates (Thisse and Thisse, 2008 (link)). After WISH, the embryos were mounted in 4 % methylcellulose, and images were captured using a Leica 205C microscope.

Liu C.X., Peng X.L., Hu C.C., Li C.Y., Li Q, & Xu X. (2016). Developmental profiling of ASD-related shank3 transcripts and their differential regulation by valproic acid in zebrafish. Development Genes and Evolution, 226(6), 389-400.

+ Open protocol

+ Expand

In Situ Detection of miRNA in Kidney Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols

6 μm FFPE kidney sections were treated with proteinase K (10 min, 37 °C), followed by fixation in 4% PFA (10 min, RT). Subsequently sections were incubated in hybridization buffer (1 hr, 52 °C) and then incubated with DIG labeled miRCURY LNA anti-miR detection probes targeting miR299a and U6 probes (18 h, 52 °C). Probe details are provided in Supplementary table 2. Stringency washes were carried out exactly as described⁶³. Sections were blocked in 1× Casein Solution (Vector labs) (1 h, RT) and incubated with anti-Digoxigenin-AP Fab fragment (1:100, 18 h, 4 °C). Chromogenic reaction was carried out using NBT/BCIP (dark, RT, 4 h–6 h) (Vector labs). Slides were then mounted with Vectamount (Vector labs) and examined using light microscopy (BX41 Olympus).

Mehta N., Li R., Zhang D., Soomro A., He J., Zhang I., MacDonald M., Gao B, & Krepinsky J.C. (2021). miR299a-5p promotes renal fibrosis by suppressing the antifibrotic actions of follistatin. Scientific Reports, 11, 88.

+ Open protocol

+ Expand

Whole Mount In Situ Hybridization and Antibody Staining

Check if the same lab product or an alternative is used in the 5 most similar protocols

For whole mount in situ hybridisation gene-specific primers were used (Metabion) to amplify gene fragments via PCR using cDNA synthesised from total RNA. The amplified fragments were subcloned into the pCR4 vector (TOPO-TA Cloning Kit, Invitrogen). In vitro transcription for synthesis of DIG-labelled RNA probes was performed using the DIG RNA Labelling Kit (Roche Applied Science). Whole mount in situ hybridisation was performed as previously described [46 ]. Staining was achieved through application of an Anti-Digoxigenin-AP antibody in combination with NBT/BCIP (Roche Applied Science).
Antibody staining was carried out as previously described [51 ] using antibodies raised against short peptides corresponding to Flipflop1 (NH2-CPKTTKPKAK-CONH2), Flipflop2 (NH2-CSKNTEHKTK-CONH2) (Pineda Antibody-Service) and Cleaved Dcp-1 (#9578, Cell Signaling Technology), respectively. A Biotin-SP-conjugated AffiniPure Anti-Rabbit lgG antibody was used as secondary antibody (Jackson ImmunoResearch Europe Ltd). Staining was carried out using Vectastain ABC-AP (Vector Laboratories) and NBT/BCIP.

Thümecke S., Beermann A., Klingler M, & Schröder R. (2017). The flipflop orphan genes are required for limb bud eversion in the Tribolium embryo. Frontiers in Zoology, 14, 48.

+ Open protocol

+ Expand

Spatiotemporal Expression of smyd4 in Zebrafish Embryos

Check if the same lab product or an alternative is used in the 5 most similar protocols

The expression of smyd4 was detected in zebrafish embryos from the 10 to 72 hpf stages using a smyd4-specific antisense probe. The template for the smyd4 probe was amplified from the cDNA of zebrafish at 24 hpf. The 508-bp fragment, which was obtained using specific primers (smyd4-probe-F: GAAGTGTGTGAAATGTGGAAAGCCTCTT and smyd4-probe-R: TTCACTCAGTTCCTGCAGTTCTTCACAG), was cloned into the pEasy-T vector (Promega, USA). After linearization of the plasmids, the antisense and sense probes were transcribed and labelled with digoxigenin in vitro. RNA in situ hybridization was performed as described previously [33 (link)]. Briefly, zebrafish embryos at different stages were collected and fixed in 4% paraformaldehyde at 4°C overnight. Embryos older than 24 hpf were digested by proteinase K at room temperature. Then, the embryos were pro-hybridized at 65°C for 4 hours and subsequently incubated with the antisense or sense probes overnight. An anti-digoxigenin antibody (Roche, USA) was used to bind the probes overnight at 4°C. Finally, the embryos were stained with NBT/BCIP (Vector, USA) and photographed in methylcellulose using a Leica M205C microscope.

Xiao D., Wang H., Hao L., Guo X., Ma X., Qian Y., Chen H., Ma J., Zhang J., Sheng W., Shou W., Huang G, & Ma D. (2018). The roles of SMYD4 in epigenetic regulation of cardiac development in zebrafish. PLoS Genetics, 14(8), e1007578.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!