Genomic DNA was extracted from young leaves of a single plant for each inbred line. ddRAD libraries for all inbred lines were constructed as previously described [21 (link)]. Briefly, 200 ng genomic DNA was digested with SacI and MseI. Restriction fragments for each individual were then ligated to the SacAD and MseAD adaptors with unique barcodes. The final ligates of 12 individuals were pooled to form a library and separated on a 2% agarose gel. Fragments in a size range between 220 and 500 bp, which corresponded to restriction fragments in a size range of 140–420 bp before adaptor ligation, were recovered from the gel and purified with a Qiagen gel purification kit (Qiagen Inc., Valenica, CA, USA). The pooled libraries were amplified and PCR products were separated on a 2% agarose gel. Fragments in a size range of 270–550 bp were purified with a Qiagen gel purification kit and submitted for sequencing on a HiSeq2000 platform with paired-end (PE) reads of 90 bp.
Gel purification kit
Manufactured by Qiagen
Sourced in United States, Germany, Canada, Spain
The Gel purification kit is a laboratory product designed to extract and purify DNA fragments from agarose gel electrophoresis. It enables the isolation and recovery of specific DNA sequences from complex mixtures.
Automatically generated - may contain errors
Lab products found in correlation
Pcr purification kit, by Qiagen (9 mentions)
2100 bioanalyzer dna 1000 chip, by Agilent Technologies (4 mentions)
Miseq platform, by Illumina (3 mentions)
Fragment analyzer ce, by Agilent Technologies (3 mentions)
Qubit dsdna high sensitivity kit, by Thermo Fisher Scientific (3 mentions)
Qubit 2.0 fluorometer, by Thermo Fisher Scientific (3 mentions)
Topo ta cloning kit, by Thermo Fisher Scientific (3 mentions)
Pef5 frt v5 dest destination vector, by Thermo Fisher Scientific (2 mentions)
Geneticin, by Thermo Fisher Scientific (2 mentions)
Pcdna3.1 vector, by Addgene (2 mentions)
Rneasy kit, by Qiagen (2 mentions)
Pjet1.2 blunt cloning vector, by Thermo Fisher Scientific (2 mentions)
Phusion high fidelity dna polymerase, by New England Biolabs (2 mentions)
Plasmid purification kit, by Qiagen (2 mentions)
Dna purification kit, by Qiagen (2 mentions)
Ez dna methylation gold kit, by Zymo Research (2 mentions)
Midiprep kit, by Qiagen (2 mentions)
Phusion high fidelity dna polymerase, by Thermo Fisher Scientific (2 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Miniprep kit, by Qiagen (2 mentions)
115 protocols using gel purification kit
1
ddRAD Library Preparation and Sequencing
2
Mutagenesis of Epitope-Tagged Receptor
3
Cloning PVT1 Exon 9 into pcDNA3.1(+)
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The PVT1 exon 9 fragment was synthesized by IDT (USA) and the dsDNA was reconstituted and amplified with polymerase chain reaction (PCR). The forward primer contained HindIII, and reverse primer contained BamHI restriction site. The PCR was performed as follows: initial denaturation of DNA at 98 °C for 30 s, an amplification program consisting of 30 cycles at 98 °C for 10 s, 55 °C for 30 s, and 72 °C for 30 s and the final extension of 1 cycle at 72 °C for 10 min. PCR product was resolved by gel electrophoresis on a 1.8% agarose gel in Tris–acetate buffer (1×). The PCR product was purified with a gel purification kit (Qiagen, Hilbert, Germany) and digested with HindIII and BamHI restriction endonucleases. The resulting gene fragment was purified and ligated into pcDNA3.1(+) vector (Addgene, Cambridge, MA, USA) digested with the same enzymes. The ligation mixture was transformed into E. coli JM109 competent cells as described by Sambrook et al. [20 ] and the recombinant plasmid was confirmed by restriction digestion by HindIII and BamHI, colony PCR as well as by sequencing. For stable cell line selection, prostate epithelial cell line (RWPE1) transfected with PVT1 exon 9 or empty pcDNA3.1 vector was grown in the presence of geneticin (Gibco, Gaithersburg, MD, USA) at a concentration of 100 μg/mL for two weeks.
4
Characterization of p53 Transcript
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cells using the Qiagen RNeasy kit. The RNA was converted to cDNA using Super Script (Invitrogen) and the p53-specific primer 5′-GTG AGA TTT CAT TGT AGG TGC CAG G-3′. The cDNA mix was then used as a template to generate overlapping PCR fragments using Promega GoTaq G2 Green master mix and the following primers: Fragment 1: 5′ GTT GCT GGG ATT GGG ACT TTC C 3′ and 5′ GTA GCA TGG GCA TCC TTT AAC TC 3′; Fragment 2: 5′GCT ATT CTG CCA GCT GGT GAA GAC 3′ and 5′ GTC TGA GTC AGG CCC CAC TTT C 3′; Fragment 3: 5′GCT ATT CTG CCA GCT GGT GAA GAC 3′ and 5′-GTG AGA TTT CAT TGT AGG TGC CAG G-3′. PCR fragments were purified using the Qiagen Gel purification kit and sequenced using the following primers: 5′ CCC AGG ATG TTG AGG AGT TTT TTG 3′; 5′ GCA TGA ACC GCC GAC CTA TCC 3′; 5′ GTA GCA TGG GCA TCC TTT AAC TC 3′; 5′ GGG ACA AAA GAT GAC AGG G 3′.
5
Expression and Purification of CdtB Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Pet28a, which is a widely used expression vector for the production of recombinant protein, was used in the present study. Briefly, CdtB gene was amplified using forward 5′ TAAGCACATATGATGAAAAAACCTGTTTTTTT 3′ and reverse primer 5′ TGCTTAAAGCTTTTAACAGCTTCGTGCCAAAA3′ having sites for HindIII and NdeI restriction enzymes, respectively. Amplified CdtB gene and vector were digested using thermo fast digest HindIII and NdeI enzymes. After digestion, both vector and gene were gel purified and ligation was done using Takara T4 DNA ligase enzyme at 16 °C for 30 min. Transformation of recombinant DNA was done into E.coli BL21(DE3) host cells using CaCl2 method26 . Transformed cells obtained on kanamycin-containing Luria-agar plates were checked for the presence of recombinant plasmid by extracting plasmid by alkaline lysis method. To confirm the integrity of the inserted DNA into the pET28a plasmid nucleotide sequencing analysis was also done. The vector was extracted from transformed BL21 (DE3) E.coli cells, purified using Qiagen gel purification kit and was sequenced using T7 promoter and terminator primers.
6
Identification of CRISPR-induced indels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNAs from the embryonic yolk sac or tail tip of pups were prepared using a Maxwll 16 system (Promega). Identification of the indels induced by DSB repair, were confirmed by PCR and subsequent DNA sequencing. The primers used for these DSB repair confirmations were Peg10-F (5′-GGAAGGTCTCAACCCAGACA-3′)/Peg10-R (5′-GTATCTCACGGTGGTCTCCC-3′), Cxx1a-F (5′-CAAATTACTTTGCTCCACTAACCCT-3′)/Cxx1a-R (5′-ATTCAGGAAGCCGTTGTAATCAT-3′), Cxx1b-F (5′-ATTGGGTAGCACTAAGGATTGTTGA-3′)/Cxx1b-R (5′-AGAGGCCTAGAAGTCCTCATCCT-3′), Rgag1-F (5′-TCTGTCCACACCTCTCATGG-3′)/Rgag1-R (5′-TGTTGCCGCTGTATCAGAAG-3′), Rsph6a-F (5′- AAGAATTCCAGGCAGGGTCCAGGATAGG-3′)/Rsph6a-R (5′- AAGGATCCCCTGGCTGAATATCTCATCC-3′), Ddx3y-F (5′- AAGAATTCCATGCCCTCATCTCAATATCCCATAAGGT-3′)/Ddx3y-R (5′- TTCTGCAGGGATAGCCATTGTTGGACTAGTTGGACA-3′) , Spaca5-F (5′- aaGCTAGCCAGTGTCCTTATCCAATCTTTCTCCCTGC-3′)/Spaca5-R (5′- AAGGATCCCCTGGCTGAATATCTCATCC-3′). Each PCR product was purified with an S-400 spin column (GE Health Care) and sequenced with each F and R primer. The extra PCR bands (RMDR alleles) were extracted with a Gel-purification kit (Qiagen) and sub-cloned into a pGEM-T easy vector (Promega), and sequenced with each F and R primer.
7
FcγRIIb Genotyping from Cord Blood
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genotyping of cord blood samples for FcγRIIb alleles was done as described before (Baerenwaldt et al., 2011 (link)). In brief, genomic DNA was isolated with the „QiaAmp DSP Blood Mini Kit “(Qiagen, Hilden) following the instructions of distributor. FcγRIIB genotyping was carried out with a two-step PCR protocol. Briefly, a 15 kb product was amplified using the Qiagen ‘LongRange PCR Kit’ (Qiagen) (Primers LongRange fwd: ctccacaggttactcgtttctaccttatcttac and LongRange rev: gcttgcgtggcccctggttctca ) generating a 14.7 kb amplicon which was purified via gel electrophoresis and by using the Qiagen ‘Gel purification Kit’. This PCR product was used as a template for the nested PCR to amplify the transmembrane region (Primers R2Btm-fwd: aaggggagcccttccctctgtt and R2Btm-rev: gtggcccctggttctcagaa ). Subsequently, the PCR product (2365 bp) was gel purified and sequenced (using the R2Bseq primer: aaggggagcccttccctctgtt ).
8
Generating Cnot3 Knockdown and Overexpression Plasmids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
GIPZ human Cnot3 shRNAs were purchased from Open Biosystems. After verification of knockdown efficiencies of all hairpins, those with greatest efficiencies were used for the generation of pHAGE-Mir vector-based constitutive or inducible shRNA plasmids. For constitutive shRNA plasmids, both GIPZ-shCnot3 and pHAGE-Mir-Phes were digested by EcoRI and ApaI. For inducible plasmids, both GIPZ-shCnot3 and pHAGE-Mir-Phes were digested by EcoRI and MluI. The digested products were extracted and purified by a Gel purification kit (Qiagen). Then, the purified Cnot3 shRNA and Phage-Mir vector was ligated at a ratio of 3:1 with the T4 ligation system at 16 °C overnight. Afterwards, the ligation product was transformed, and amplified for the use in the future.
To generate Cnot3 overexpression plasmids, the coding region of human Cnot3 was amplified by RT-PCR and cloned into pHAGE-EF1α or pHAGE-Inducible destination expression vectors using Gateway cloning. The cloned human Cnot3 fragment was sequenced, and the expression of Cnot3 was verified in subsequent experiments.
To generate Cnot3 overexpression plasmids, the coding region of human Cnot3 was amplified by RT-PCR and cloned into pHAGE-EF1α or pHAGE-Inducible destination expression vectors using Gateway cloning. The cloned human Cnot3 fragment was sequenced, and the expression of Cnot3 was verified in subsequent experiments.
9
Nucleosomal DNA Construction Protocol
10
APOE Gene Sequencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sequencing of the four coding exons of APOE was undertaken using a five amplicon design, with Exons 1 through 3 amplified as a single amplicon and Exon 4 split in two overlapping amplicons. Exons were amplified via PCR using GoTaq DNA polymerase, 200μM of each dNTP, 1.5 mM MgCl2 and primers specific for each exon (Table 1 ). Thermocycler conditions included an initial denaturation step at 95°C for 2 min, followed by 35 cycles of: 94°C for 30 s, annealing temperature (Table 1 ) for 30 s and 72°C for 30 s. Finally, at the end of the 35 cycles a 7-min adenylation step was undertaken. To remove impurities, unpurified PCR sample templates were cleaned by Solid Phase Reversible Immobilization (SPRI), which utilized paramagnetic beads. The second part of the Exon 4 required the band to be gel purified using the Qiagen gel purification kit. Samples were quantified by gel electrophoresis against a DNA ladder of known concentration. Purified DNA fragments were then sequenced using the Big Dye version 3.1 chemistry (Applied Biosystems) and post-cleaned using SPRI. Fragments were separated on a 3730xI DNA Analyzer, using a 96-capillary array (Applied Biosystems) at the Australian Genome Research Facility (Perth, Australia).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!