RNA was converted to cDNA using reverse transcriptase (Promega) according to the manufacturer’s instructions. Samples were run in duplicate via qPCR on a Roche LightCycler 480 using SYBR Advantage qPCR Premix (Clontech). The expression levels were quantified and normalized to housekeeping gene GAPDH (glyceraldehyde-3-phosphate dehydrogenase). The following qPCR primer pairs were custom ordered from Integrated DNA Technologies: IL1β-F (GAAATGCCACCTTTTGACAGTG) and IL1β-R (TGGATGCTCTCATCAGGACAG); IL-6-F (CCAAGAGGTGAGTGCTTCCC) and IL-6-R (CTGTTGTTCAGACTCTCTCCCT); IRF3-F (GAGAGCCGAACGAGGTTCAG) and IRF3-R (CTTCCAGGTTGACACGTCCG); and GAPDH-F (AGGTCGGTGTGAACGGATTTG) and GAPDH-R (TGTAGACCATGTAGTTGAGGTCA).
Lightcycler 480
Manufactured by Takara Bio
Sourced in Japan, China, Switzerland
The LightCycler 480 is a real-time PCR system designed for quantitative nucleic acid analysis. It features a 96-well plate format and can perform high-throughput qPCR experiments. The system utilizes optical detection technology to monitor the progress of PCR reactions in real-time.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (10 mentions)
Sybr premix ex taq 2, by Takara Bio (6 mentions)
Sybr premix ex taq, by Takara Bio (6 mentions)
Reverse transcription kit, by Takara Bio (5 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (4 mentions)
Primescript rt reagent kit, by Takara Bio (4 mentions)
Sybr green, by Takara Bio (3 mentions)
Tb green premix ex taq 2, by Takara Bio (3 mentions)
Trizol reagent, by Takara Bio (3 mentions)
Sybr advantage qpcr premix, by Takara Bio (2 mentions)
Reverse transcriptase, by Promega (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Direct zol rna miniprep kit, by Zymo Research (2 mentions)
Sybr green 1 master mix, by Takara Bio (2 mentions)
M mlv reverse transcriptase, by Takara Bio (2 mentions)
Sybr green master mix, by Takara Bio (2 mentions)
Sybr green system, by Takara Bio (2 mentions)
Primescript regent kit with dnaase, by Takara Bio (2 mentions)
Sybr premix ex taq gc dye, by Takara Bio (2 mentions)
Sybr premix ex taq 2 kit, by Takara Bio (2 mentions)
52 protocols using lightcycler 480
1
Quantitative Analysis of Inflammatory Markers
2
Intestinal Gene Expression Analysis
3
Transcriptional Profiling of Undifferentiated Cell Populations
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sorted cells were lysed in TRIzol LS reagent (Thermo Fisher Scientific) then RNA was purified and DNase treated using a Direct-zol RNA Miniprep kit (Zymo Research). Gene expression in Aundiff fractions from pooled Oct4-GFP; Plzf-mC/CreER mice (three independent sorts) was analysed with an Agilent Technologies SurePrint G3 8 × 60 K microarray at the Monash Health Translation Precinct Genomics Facility. Significance was determined by paired t test (P < 0.05) with 1.5-fold change cutoff. For qRT-PCR, cDNA was synthesized from isolated RNA using a Tetro cDNA synthesis kit (Bioline). Quantitative PCRs were run on a Roche LightCycler 480 using Takara Sybr Premix Ex Taq II (Clontech). Primer sequences were as previously described20 (link),23 (link) or obtained from the Harvard PCR Primer Bank (https://pga.mgh.harvard.edu/primerbank/ ) and listed in Supplementary Table 1 .
4
Quantitative gene expression analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from cecum, liver, and spleen as before and converted to cDNA using reverse transcriptase (Promega) according to the manufacturer’s instructions. Expression analysis was performed in duplicate via qPCR on a Roche LightCycler 480 using SYBR Advantage qPCR Premix (Clontech).
Expression levels were quantified and normalized to housekeeping genes HPRT (for qPCR on organs in both mouse models), GAPDH (for in vitro MEF experiments), or ASL (for 16S relative expression). For Fig.3b , Supplementary Fig. 3a , and Fig. 4d , relative expression values were normalized to the mean of the untreated controls for each organ and displayed as fold change to allow for display on the same axis. For Fig. 3c , Supplementary Fig. 3b, c , and Fig. 4b , relative expression values were normalized to untreated MEF baseline relative expression for each gene (indicated with a dotted line at 1) and displayed as fold change. For Supplementary Fig. 4a , the number of 16S copies was calculated using a purified Ruminococcus productus DNA standard and normalized to the relative expression of host ASL for each mouse assessed61 (link). The qPCR primers shown in Supplementary Table 4 were custom ordered from Integrated DNA Technologies.
Expression levels were quantified and normalized to housekeeping genes HPRT (for qPCR on organs in both mouse models), GAPDH (for in vitro MEF experiments), or ASL (for 16S relative expression). For Fig.
5
Quantifying Liver RNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from liver was extracted using the RNA sample Total RNA Kit (Tiangen, Beijing, China). cDNA was synthesis using reverse transcription kit (FastQuant RT Kit, Tiangen) according to manufacturer’s instructions. Real-time PCR was performed using the Roche Light-Cycler 480 with SYBR Premix Ex Taq II (Takara, Dalian, China). Relative expression of the target genes was calculated using the 2−∆∆Ct method (18 ). Statistical analysis was performed using GraphPad Prism 8.00
6
RNA Extraction and Real-Time qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We subjected 10 µg of total RNA to DNaseI treatment with 1 U DNaseI (NEB, New England Biolabs, MA). The reaction was carried out at 37°C for 15 minutes followed by heat inactivation at 85°C for 5 seconds. We then used 2 µg of DNase‐treated RNA for cDNA synthesis with reverse transcriptase (Bio‐Rad, CA), in accordance with the manufacturer's protocol. Primers were designed for selected transcripts from the transcriptome database (Table 1 ), and real‐time polymerase chain reaction (PCR) was performed with SYBR Green I master mix (Takara, Dalian City, Liaoning Province, China) on the fluorescent quantitative PCR apparatus (Lightcycler480).
7
Switchgrass Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Each of the PvTCPs' transcript sequence was used as a query to blast against the public database of switchgrass (https://switchgrassgenomics.noble.org/ ). The expression data of spatiotemporal patterns were retrieved, and pretty heatmap was constructed using the online program ImageGP (http://www.ehbio.com/ImageGP/ ). Total RNA of samples were extracted using the TRIzol method (Invitrogen Life Technologies, USA). The isolated RNA was subsequently treated with RNase-Free DNase I (Roche, http://www.roche.com ). The first-strand cDNA was synthesized from 1 μg of total RNA of each sample, using M-MLV reverse transcriptase (TaKaRa, http://www.takarabiomed.com.cn/ ) according to the protocol. The primers used in this study were showed in Table S1 . PvUBQ (GenBank accession number: HM209468) was used as the reference gene. qRT-PCR was performed with real-time PCR system (LightCycler 480) using TB Green Premix EX Taq II kit (TaKaRa, Japan) and the methods described in the previous study [32 (link)]. Each PCR assay was run in triplicate for three independent biological repeats.
8
Quantifying mRNA Expression in Gliomas
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All human glioma tissues and corresponding clinical information were obtained from the Department of Neurosurgery of Wuhan Union Hospital from July 2017 to July 2021. The clinicopathological characteristics of the patients were summarized in Additional file 1 : Table S1 Fresh tumor tissues were resected and immediately preserved in liquid nitrogen. Total RNA was extracted from each sample. According to the manufacturer's instructions, cDNA was synthesized by reverse transcription using a reverse transcription kit (Takara RR036A). qRT‒PCR analysis was further performed on a LightCycler 480 Real-Time PCR system using TB Green® Premix Ex Taq™ II (Takara RR820A). GAPDH was used for normalization, and the comparative Ct method (ΔΔCt) was used to evaluate mRNA expression. The primer sequences are listed in Additional file 3 : Table S3.
9
Gene Expression Analysis by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were subjected to RNA extraction using TRIzol reagent (Invitrogen, USA). qRT-PCR was performed with a Roche LightCycler 480 using SYBR Green Master Mix (Takara, China) according to the manufacturer’s instructions. The relative mRNA expression levels of investigated genes were normalized to GAPDH using the 2−ΔΔCt method. All experiments were performed in triplicate. The primer pairs of qRT-PCR were as follows: GAPDH (5′-GGA GCG AGA TCC CTC CAA AAT-3′ and 5′-GGC TGT TGT CAT ACT TCT CAT GG-3′), HDAC2 (5′-ATG GCG TAC AGT CAA GGA GG-3′ and 5′-TGC GGA TTC TAT GAG GCT TCA-3′), PTEN (5′-TTT GAA GAC CAT AAC CCA CCAC-3′ and 5′-ATT ACA CCA GTT CGT CCC TTT C-3′), Cyclin A2 (5′-GGA TGG TAG TTT TGA GTC ACC AC-3′ and 5′-CAC GAG GAT AGC TCT CAT ACT GT-3′), Cyclin D1 (5′-GCT GCG AAG TGG AAA CCA TC-3′ and 5′-CCT CCT TCT GCA CAC ATT TGA A-3′), and p21 (5′-TGT CCG TCA GAA CCC ATG C-3′ and 5′-AAA GTC GAA GTT CCA TCG CTC-3′). The primers of U6 and miR-3691-5p were purchased from Genecopoeia.
10
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All experiments were performed according to the standard procedure in our lab (Zhang et al., 2016 (link); Qin et al., 2018 (link)). In brief, total RNA was extracted using TRIzol reagent (Invitrogen, United States) according to the manufacturer’s protocol. The purity and yield of RNA were detected by a NanoDrop 2000C spectrophotometer (Thermo Fisher Scientific, United States), and the integrity of RNA was determined by gel electrophoresis. One microgram of RNA was used as a template for the first strand cDNA synthesis using the reverse-transcription kit described above. Real-time quantitative PCR (qPCR) was performed on a Roche Light-Cycler 480 real time PCR system using SYBR Premix Ex TaqTM (TAKARA, Japan). qPCR conditions were as follows: denaturation at 94°C for 3 min, followed by 40 cycles at 94°C for 15 s, 55–58°C for 15 s, and 72°C for 20 s. At the end of the amplification, a melting curve analysis was generated to confirm the presence of a single PCR product. The housekeeping gene β-actin was used as an internal reference gene. The expression levels of each target gene analyzed via qPCR were determined using the comparative quantification method 2-ΔΔCT (Livak and Schmittgen, 2001 (link)).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!