Redextract n amp tissue pcr kit

Manufactured by Merck Group

Sourced in United States, United Kingdom, Germany, Israel

The REDExtract-N-Amp Tissue PCR Kit is a laboratory equipment product designed for the extraction and amplification of DNA from tissue samples. It provides a rapid and efficient method for DNA isolation and PCR amplification in a single tube.

Automatically generated - may contain errors

Lab products found in correlation

Redextract n amp pcr reaction mix, by Merck Group (2 mentions) Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (2 mentions) Agrp cre mice, by Jackson ImmunoResearch (2 mentions) B6 129s4 socs3tm1ayos j, by Jackson ImmunoResearch (2 mentions) Sybr safe dna gel stain, by Thermo Fisher Scientific (2 mentions) Gelred, by Biotium (2 mentions) Pflf1, by New England Biolabs (2 mentions) Wizard sv genomic dna purification system, by Promega (2 mentions) Herculase 2 polymerase, by Agilent Technologies (2 mentions) Automacs, by Miltenyi Biotec (1 mentions) Wizard genomic dna purification kit, by Promega (1 mentions) Phire tissue direct pcr master mix, by Thermo Fisher Scientific (1 mentions) Minelute pcr purification column, by Qiagen (1 mentions) Cell lysis solution, by Qiagen (1 mentions) Rnase a solution, by Merck Group (1 mentions) Puromycin, by Thermo Fisher Scientific (1 mentions) Thermal cycler, by Thermo Fisher Scientific (1 mentions) Redextract n amp pcr readymix, by Merck Group (1 mentions) Tcf lef h2b gfp mice, by Jackson ImmunoResearch (1 mentions) 3730xl dna sequencer, by Macrogen (1 mentions)

Spelling variants of this product

REDExtract-N-AmpTM Tissue PCR Kit (17 citations) REDExtract-N-Amp (8 citations) Tissue PCR Kit (3 citations)

165 protocols using redextract n amp tissue pcr kit

Genotyping CD169 Knockout Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

CD169 knockout animals were ear punched after weaning for genotyping. RedExtract-N-Amp Tissue PCR Kit (Sigma, Cat#E7526) was used according to manufacturer's protocol. PCR reaction was prepared using RedExtract-N-Amp Tissue PCR Kit (Sigma, Cat#R4775) according to manufacturer’s protocol.
To determine the effectiveness of the CD169 KO, the following PCR protocol was used. CD169 Primers: Forward - CAC CAC GGT CAC TGT GAC AA, Reverse - GGC CAT ATG TAG GGT CGT CT. Both primers are used at a final concentration of 1µM with the following PCR program:1. 92°C for 2:00, 2. 92°C for 0:30, 3. 57°C for 0:30, 4. 72°C for 1:30, 5. Repeat step #2 x35, 6. 72°C for 5:00, 7. Store at 4°C. When the transgene is present the expected product is 1,700 bp, as compared to 486 bp in WT mice.

Lisk C., Yuen R., Kuniholm J., Antos D., Reiser M.L, & Wetzler L.M. (2021). CD169+ Subcapsular Macrophage Role in Antigen Adjuvant Activity. Frontiers in Immunology, 12, 624197.

+ Open protocol

+ Expand

Genotyping and Cell Separation for Orai1 Deletion

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mice were genotyped at JAX: the presence of the floxed gene was demonstrated by PCR, with flox-F ACC CAT GTG GAA AGA AA and flox-R TGC AGG CAC TAA AGA CGA TG primers producing a 505 bp amplicon.^{9 (link)} For evaluation of cre recombination, the flox-F primer was paired with excision-R primer CAG AAA GAA CTA CAC AGA GAA ATC; excision results in a 520 bp amplicon. Mice with desired genotype from JAX were shipped for analysis. Genomic DNA was isolated from fresh lysates of whole marrow and spleen cells for PCR genotyping using REDExtract-N-Amp tissue PCR kit (Sigma, St. Louis, MO). To confirm Orai1 deletion from myeloid monocytic cells, spleens were gently dissociated in PBS pH 7.2, 0.5% BSA, and 2 mM EDTA. Cells were incubated with anti-F4/80-linked magnetic micro-beads and separated by AutoMACS (Miltenyi Biotech, Bergisch Gladbach, Germany). Aliquots of unsorted spleen cells were also frozen for Western blot analysis (see below). Genomic DNA for PCR was extracted from F4/80-positive and negative cells (Sigma REDExtract-N-Amp tissue PCR kit). Amplification used 94°C, 4 minutes, 30 cycles of 94°C, 30 seconds, 58°C, 30 seconds, and 72°C, 30 seconds and final extension 72°C, 2 minutes. Products were separated on 1.5% agarose.

Robinson L.J., Soboloff J., Tourkova I.L., Larrouture Q.C., Witt M.R., Gross S., Hooper R., Samakai E., Worley P.F., Barnett J.B, & Blair H.C. (2021). The function of the calcium channel Orai1 in osteoclast development. FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 35(6), e21653.

+ Open protocol

+ Expand

Genotyping Fendrr Null and Box Mutants

Check if the same lab product or an alternative is used in the 5 most similar protocols

The REDExtract-N-Amp™ Tissue PCR Kit (Merck, XNAT) was used for genotyping for all tissue explants. Genotyping of FendrrNull (Fendrr^3xpA^/3xpA) embryos with the three primers: Fendrr3xpA_F1: GCGCTCCCCACTCACGTTCC, Fendrr3xpA_Ra1: AGGTTCCTTCACAAAGATCCCAAGC, genoNCrna_Ra4: AAGATGGGGAACCGAGAATCCAAAG that will generate a 696bp band in wild type and a 371bp band when the 3xpA allele is present. Genotyping of FendrrBox (Fendrr^{em7Phg/em7Phg}) embryo tissues with: FendrrBox_F2: ATGCTTCCAAGGAAGGACGG, FendrrBox_R2: CTTGACGCCAAGCTCCTGTA that generate a 602bp product in wild type and a 503bp product when the FendrrBox is missing.

Ali T., Rogala S., Krause N.M., Bains J.K., Melissari M.T., Währisch S., Schwalbe H., Herrmann B.G, & Grote P. (2023). Fendrr synergizes with Wnt signalling to regulate fibrosis related genes during lung development via its RNA:dsDNA triplex element. Nucleic Acids Research, 51(12), 6227-6237.

+ Open protocol

+ Expand

Genomic DNA Extraction and PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Extraction was performed following protocols based on the manufacturer’s recommendations; Wizard^® Genomic DNA purification kit (#A1120, Promega, Madison, WI, USA) for CA1 and CFBE populations, REDExtract-N-Amp™ Tissue PCR kit (#XNAT Merck, Kenilworth, NJ, USA) for iPSC populations, Phire Tissue Direct PCR Master Mix (#F170S, Thermo Fisher Scientific, Waltham, MA, USA), following the manufacturer’s dilution protocol, was used for direct gDNA extraction from the hPSC clones. The extracted gDNA was used to perform PCR reactions with several purposes, including sequencing analysis (Table S1). Allele-specific PCR (ASPCR) was performed using primers designed to selectively amplify the unmodified or correctly modified sequences (Table S1). The results were analysed by 1–1.5% agarose gel electrophoresis.

Cuevas-Ocaña S., Yang J.Y., Aushev M., Schlossmacher G., Bear C.E., Hannan N.R., Perkins N.D., Rossant J., Wong A.P, & Gray M.A. (2023). A Cell-Based Optimised Approach for Rapid and Efficient Gene Editing of Human Pluripotent Stem Cells. International Journal of Molecular Sciences, 24(12), 10266.

+ Open protocol

+ Expand

Genotyping G1 Offspring via Illumina Arrays

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA from G₁ offspring and control birds [Hy-line Brown, iCaspase9 (bred on a Hy-line Brown background), and Silkie broiler birds] were genotyped using a custom Cobb 60K Infinium Illumina array. Genomic DNA was prepared from blood from G₁ chicks using cell lysis solution (Qiagen) containing RNAse A Solution (Merck). In some instances, extra embryonic chorioallantoic membrane samples were used instead of blood and genomic DNA was extracted using REDExtract-N-Amp Tissue PCR Kit (Merck) and cleaned up using Qiagen MinElute PCR purification columns.

Ballantyne M., Taylor L., Hu T., Meunier D., Nandi S., Sherman A., Flack B., Henshall J.M., Hawken R.J, & McGrew M.J. (2021). Avian Primordial Germ Cells Are Bipotent for Male or Female Gametogenesis. Frontiers in Cell and Developmental Biology, 9, 726827.

+ Open protocol

+ Expand

Genotyping Fendrr Knockout Mouse Alleles

Check if the same lab product or an alternative is used in the 5 most similar protocols

The mESC were either cultured in feeder free 2i media or on feeder cells (mitomycin inactivated SWISS embryonic fibroblasts) containing LIF1 (1000 U/ml). GGGAAGACATGGGGGAGTAA. Wild-type F1G4 cells were transiently transfected with 2μg/mL puromycin (Gibco, #10130127) for 2 days and 1μg/mL puromycin for 1 day. Single mESC clones were picked 7-8 days after transfection and plated onto 96-well synthemax (Sigma, #CLS3535) coated plates and screened for genomic DNA deletion by PCR using primers outside of the deletion region.
Genotyping of Fendrr 3xpA/3xpA and Fendrr em7Phg/em7Phg tissues
The REDExtract-N-Amp™ Tissue PCR Kit (Merck, XNAT) was used for genotyping for all tissue explants. Genotyping of FendrrNull (Fendrr 3xpA/3xpA ) embryos with the three primers:
Fendrr3xpA_F1: GCGCTCCCCACTCACGTTCC, Fendrr3xpA_Ra1:
AGGTTCCTTCACAAAGATCCCAAGC, genoNCrna_Ra4:
AAGATGGGGAACCGAGAATCCAAAG that will generate a 696bp band in wild type and a 371bp band when the 3xpA allele is present. Genotyping of FendrrBox (Fendrr em7Phg/em7Phg ) embryo tissues with: FendrrBox_F2: ATGCTTCCAAGGAAGGACGG, FendrrBox_R2:
CTTGACGCCAAGCTCCTGTA that generate a 602bp product in wild type and a 503bp product when the FendrrBox is missing.

Ali T., Rogala S., Krause N., Bains J.K., Melissari M., Waehrisch S., Herrmann B.G., Schwalbe H., & Grote P. (2021). Fendrr synergizes with Wnt signalling to regulate fibrosis related genes during lung development via its RNA:dsDNA Triplex Element.

+ Open protocol

+ Expand

Lineage Tracing of Pdgfrb-Expressing Cells

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

The Itgb1^fl/fl and CreER^TM mice have been described previously21 (link). Adult (8 weeks old) male mice were used and genotyping was performed from DNA prepared from ear clips using the REDExtract-N-Amp Tissue PCR Kit (Sigma) and PCR primers for integrin beta-1 forward 5′-TTCTGCAAGTGTGGTG-3′ and reverse 5′-TGCCACTCCAAACATAGAGC-3′ and for β-actin CreER forward 5′-AACCTGGATAGTGAAACAGGGGC-3′ and reverse 5′-GGAACCGACTTGACGTAGCCAGC-3′. Male Sprague–Dawley rats for HSC isolation were purchased from Charles River Laboratories, UK. Pdgfrb-BAC-eGFP mice (provided by Professor Neil Henderson, University of Edinburgh, UK) on a C57BL/6 background carrying one copy of a BAC transgene expressing enhanced green-green fluorescent protein (eGFP) under the control of Pdgfrb regulatory elements have been described previously18 (link). Animals were housed and maintained, and animal experiments performed under approval from the University of Manchester Ethical Review Committee and UK Government Home Office licence for animal research.

Martin K., Pritchett J., Llewellyn J., Mullan A.F., Athwal V.S., Dobie R., Harvey E., Zeef L., Farrow S., Streuli C., Henderson N.C., Friedman S.L., Hanley N.A, & Piper Hanley K. (2016). PAK proteins and YAP-1 signalling downstream of integrin beta-1 in myofibroblasts promote liver fibrosis. Nature Communications, 7, 12502.

+ Open protocol

+ Expand

Genotyping of Misr2-Cre Transgenic Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

This study was performed in accordance with experimental protocols 2009N000033 and 2014N000275 approved by the Massachusetts General Hospital Institutional Animal Care and Use Committee. Strains of Sprague–Dawley (purchased from Envingo) and Friend leukemia virus B (FVB) (purchased from Charles River Laboratories) were used for rat and mouse experiments, respectively. Misr2/Amhr2-Cre knock-in mice were purchased from the Mutant Mouse Regional Resource Centers (MMRRC) (strain B6;129S7-Amhr2tm3(cre)Bhr/Mmnc, backcrossed with C57BL/6J) (Jamin et al., 2002 (link)). Tail genotyping of the Misr2-cre knock-in and WT mice were done with REDExtract-N-Amp Tissue PCR Kit (Sigma, #SLBT8193) with the previously described sets of primers (Jamin et al., 2002 (link)).

Saatcioglu H.D., Kano M., Horn H., Zhang L., Samore W., Nagykery N., Meinsohn M.C., Hyun M., Suliman R., Poulo J., Hsu J., Sacha C., Wang D., Gao G., Lage K., Oliva E., Morris Sabatini M.E., Donahoe P.K, & Pépin D. (2019). Single-cell sequencing of neonatal uterus reveals an Misr2+ endometrial progenitor indispensable for fertility. eLife, 8, e46349.

+ Open protocol

+ Expand

Genotyping Genomic Variation in Prawns

Check if the same lab product or an alternative is used in the 5 most similar protocols

The second pleopods were dissected from prawns bearing different chromosome combinations: a ZZ normal male, a sex-reversed normal female (expected to be a WZ neo-male^{18 (link)}), a sex-reversed super female (expected to be a WW neo-male), a WZ normal female, a super female from a WZ × WZ cross (expected to be WW^{18 (link)}), and a sex-reversed neo-female that was obtained by silencing the Mr-IAG gene (expected to be ZZ^{32 (link)}). Genomic DNA was extracted using REDExtract-N-Amp Tissue PCR Kit (Sigma, Rehovot, Israel) according to the manufacturer’s instructions, and the genotype of each animal was determined using sex-specific genomic markers for M. rosenbergii, as previously described^{18 (link)}.

Levy T., Rosen O., Manor R., Dotan S., Azulay D., Abramov A., Sklarz M.Y., Chalifa-Caspi V., Baruch K., Shechter A, & Sagi A. (2019). Production of WW males lacking the masculine Z chromosome and mining the Macrobrachium rosenbergii genome for sex-chromosomes. Scientific Reports, 9, 12408.

+ Open protocol

+ Expand

DNA Extraction and Genotyping of Mouse Tails

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA extraction from mouse tail clips obtained at 7–10 days of age was performed using REDExtract-N-Amp™ Tissue PCR Kit (Cat#R4775, Sigma-Aldrich, St. Louis, MO, USA) following the manufacturer’s protocol. In brief, tail clips were combined with 100 μL of extraction solution and 25 μL of tissue preparation solution and mixed by vortexing. Samples were incubated for 15 min at room temperature followed by incubation at 95 °C for 5 min. A total of 100 μL of neutralization solution was added to each sample and again mixed by vortexing.
The extracted DNA was subsequently used to perform genotyping PCR. The primers of interest were combined with the extracted DNA, double-distilled water, and REDExtract-N-Amp™ PCR Ready Mix (Cat#R4775, Sigma-Aldrich, St. Louis, MO, USA) to obtain a total volume of 20 μL per reaction. PCR was performed using an Applied Biosystems Thermal Cycler; individual thermal protocols were primer-specific (Supplementary Table S1). A total of 2.5–8 μL of the final samples were run out on 1.5% agarose gels for BAP1 and Kras specimens and 3% agarose gels for Alb-Cre specimens. Primer sequences and expected amplicon sizes are found in Supplementary Figure S1.

Marcus R., Ferri-Borgogno S., Hosein A., Foo W.C., Ghosh B., Zhao J., Rajapakshe K., Brugarolas J., Maitra A, & Gupta S. (2021). Oncogenic KRAS Requires Complete Loss of BAP1 Function for Development of Murine Intrahepatic Cholangiocarcinoma. Cancers, 13(22), 5709.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!