Log In Sign up
The largest database of trusted experimental protocols

Cell cycle kit

Manufactured by Beyotime
Visit Supplier
Sourced in China, United States, Japan

The Cell Cycle Kit is a laboratory product designed to analyze and study the different phases of the cell cycle. It provides the essential tools and reagents required to perform cell cycle analysis through methods such as flow cytometry or fluorescence microscopy. The kit includes the necessary buffers, dyes, and control samples to enable researchers to accurately determine the distribution of cells in the G1, S, and G2/M phases of the cell cycle.

Automatically generated - may contain errors

Lab products found in correlation

Facscalibur, by BD (4 mentions) Trypsin, by Thermo Fisher Scientific (2 mentions) Modfit version 3.1, by BD (2 mentions) Lsrfortessa flow cytometer, by BD (2 mentions) Annexin 5 af647 pi kit, by 4A Biotech (2 mentions) Accuri c6 flow cytometer, by BD (2 mentions) Accuri c6, by BD (2 mentions) Fetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions) Flow cytometry, by BD (2 mentions) Fitc annexin 5 apoptosis detection kit, by BD (2 mentions) Canto 2, by BD (1 mentions) Phosphate buffered saline (pbs), by Thermo Fisher Scientific (1 mentions) Annexin 5 apoptosis detection kit, by BD (1 mentions) Edu kit, by Beyotime (1 mentions) Modfit, by Verity Software House (1 mentions) Annexin 5 fitc pi apoptosis kit, by Beyotime (1 mentions) Cell culture medium, by Thermo Fisher Scientific (1 mentions) Penicillin streptomycin, by Thermo Fisher Scientific (1 mentions) Calcein am, by Beyotime (1 mentions) Cell counting kit 8 cck 8, by Yeasen (1 mentions)

53 protocols using cell cycle kit

1

Cell Cycle, Differentiation and Apoptosis Analysis

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
For cell growth analysis, the cells were fixed the with 4% paraformaldehyde (Solarbio, P1110) for 15 min at room temperature, then permeated with 0.3% Triton-X (Solarbio, 9002-93-1) for 15 min at room temperature. Next the cells were stained with EdU according to the instruction of EdU kit (Beyotime, C0071L), and analyzed the percentage of the EdU positive cells by flow cytometer (BD Canto II). The cell cycles were performed following the instructions of the cell cycle kit (Beyotime, C1052).
To analyze the differentiation of cell, the cells were incubated with anti-human CD11b, CD15 antibody (BioLegend) at 4 °C for 30 min then washed once with PBS (Gibco). The proportion of CD11b+ CD15+ cells (differentiated myeloid cell) [41 (link)] was detected by flow cytometer. On the other hand, for morphology analysis, we spined these cells to slide and stained them with Wright-Giemsa dye, then to observe under the microscope (Leica).
Cells apoptosis was tested by Annexin-V Apoptosis Detection Kit (BD, 559763). Generally, cells were mixed with 100ul binding buffer supplemented with 1ul Annexin-V PE and 1ul 7-AAD incubating at 4 °C for 30 min, then to analyze by the flow cytometer.
ALL results of flow cytometer were analyzed by FlowJo V10.
Wu W., Jiang Y., Xing D., Zhai Y., Sun H., He X., Luo K., Xu P., Pan F., Dong G., Ren G, & Zhao Z. (2024). The epigenetic regulators EP300/CREBBP represent promising therapeutic targets in MLL-rearranged acute myeloid leukemia. Cell Death Discovery, 10, 206.
+ Open protocol
+ Expand
2

Cell Cycle Analysis by Flow Cytometry

Check if the same lab product or an alternative is used in the 5 most similar protocols
Flow Cytometry was applied to analyze the cell cycle. Cells were collected by the pancreatic enzyme and washed by PBS (pH = 7.2) for three times, then the samples were prepared by using Cell Cycle Kit (Beyotime Biotechnology, C1052) and analyzed by Accuri C6 (BD Biosciences, New York, America). The analyzed documents were processed by ModFit (Verity Software House, GA, America) to identify the cell cycle dynamic.
Zhai J., Gao C., Fu L., Jing L., Dang S, & Zheng S. (2018). Integrative Analyses of Transcriptome Sequencing Identify Functional miRNAs in the Chicken Embryo Fibroblasts Cells Infected With Reticuloendotheliosis Virus. Frontiers in Genetics, 9, 340.
+ Open protocol
+ Expand
3

Deferasirox Cytotoxicity in Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Deferasirox was purchased from Aladdin Biotechnology (Shanghai, Chain). Cell culture medium, trypsin, penicillin-streptomycin and fetal bovine serum were purchased from Gibco (Guangzhou, China). Cell counting kit-8 (CCK8) was purchased from Yeasen (shanghai, China). Annexin V-FITC/PI apoptosis Kit, cell cycle kit, mitochondria membrane potential detection (JC-1) kit and calcein-AM were purchased from Beyotime (Shanghai, China).
Liu P., Wang Q., Li K., Bi B., Wen Y.F., Qiu M.J., Zhao J., Li B.B., Zhang C.H, & He Y.L. (2022). A DFX-based iron nanochelator for cancer therapy. Frontiers in Bioengineering and Biotechnology, 10, 1078137.
+ Open protocol
+ Expand
4

Cell Cycle and Apoptosis Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cell cycle was analyzed by cell cycle kit (Beyotime, China) according to the manufacturer's instructions. Firstly, cells transfected with siRNA were plated in six-well plates for 48 h. Then cells were collected and incubated with propidium iodide for 30 min in the dark. By flow cytometer (BD USA), cell cycle was analyzed and data were present as percentage distribution of cells in G0/G1, S and G2/M phases of the cell cycle.
Apoptosis assay was performed with an Annexin V-APC antibody (Beyotime, China) and 7-AAD antibody (KeyGEN, China). Cells transfected with siRNA were plated in six-well plates for 48 h. Then cells were harvested and washed three times in PBS. Cells were incubated in 300 μl binding buffer added with 10 μ l of 7-AAD and 5 μ l of Annexin V-APC for 15 min. Finally, cells were analyzed by flow cytometry (10,000 cells; BD USA).
Wang X., Yu Y., He Y., Cai Q., Gao S., Yao W., Liu Z., Tian Z., Han Q., Wang W., Sun R., Luo Y, & Li C. (2017). Upregulation of ALDH1B1 promotes tumor progression in osteosarcoma. Oncotarget, 9(2), 2502-2514.
+ Open protocol
+ Expand
5

Apoptosis and Cell Cycle Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
An apoptosis kit (MultiSciences Biotech, Hangzhou, China) and a cell cycle kit (Beyotime) were used according to the manufacturers' manuals. In the apoptosis assay, the cells were seeded in 6-well plates and VP treatment was as CCK-8 assay. After VP light activation for 24 h, the cells were harvested and washed twice with cold phosphate buffer saline (PBS) and stained with Annexin V-fluorescein isothiocyanate (FITC) and propidium iodide (PI) in the dark at room temperature for for 15 min. In the cell cycle assay, the cells were seeded in 6-well plates using non-serum cell culture medium for 12 h. Then the cells were treated with VP as CCK-8 assay. After VP light activation for 24 h, the cells were harvested, fixed in 70% ethanol at 4°C overnight, and then stained with PI at 4°C for 30 min in the dark. Stained cells were analyzed using a FACSCalibur flow cytometer (BD Biosciences).
Liu K., Du S., Gao P, & Zheng J. (2019). Verteporfin suppresses the proliferation, epithelial-mesenchymal transition and stemness of head and neck squamous carcinoma cells via inhibiting YAP1. Journal of Cancer, 10(18), 4196-4207.
+ Open protocol
+ Expand
6

Cell Cycle Analysis of Embryonic Myoblasts

Check if the same lab product or an alternative is used in the 5 most similar protocols
In accordance with the cell cycle kit instructions (Beyotime, Shanghai, China), embryonic myoblasts were seeded into the 6-well plates cultured in GM, and were transfected for 24–48 h. Briefly, the cells were digested by trypsin to be collected into a 1.5 mL centrifuge tube, then pre-cooled 70% ethanol was added to cells for fixation overnight at 4 °C. The propidium (PI) staining solution was prepared according to the instructions to dye the cell samples in darkness at 37 °C for 30 min. The DNA content of the cells was detected by the BD LSRFortessa flow cytometer (BD, Franklin Lakes, NJ, USA) after PI staining, and the distribution of DNA content was analyzed using Modfit (Version: 3.1) (Topsham, ME, USA).
Ge L., Su P., Wang S., Gu Y., Cao X., Lv X., Wang S., Getachew T., Mwacharo J.M., Haile A., Yuan Z, & Sun W. (2022). New Insight into the Role of the Leucine Aminopeptidase 3 (LAP3) in Cell Proliferation and Myogenic Differentiation in Sheep Embryonic Myoblasts. Genes, 13(8), 1438.
+ Open protocol
+ Expand
7

Cell Proliferation, Apoptosis and Cycle Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cell proliferation, apoptosis and cell cycle were analysed by flow cytometry using the BeyoClick™ EdU Cell Proliferation Kit with Alexa Fluor 647 (Beyotime), Annexin V-APC Apoptosis Analysis Kit (Sungene Biotech, Tianjin, China) and Cell Cycle Kit (Beyotime), respectively, according to the manufacturer’s protocol. Cells were acquired on a CytoFLEX flow cytometer (Beckman Coulter, Florida, USA), and data were analysed by FlowJo software (Tree Star, Inc., Ashland, OR, USA).
Xiang Y., Yu Y., Li Q., Jiang Z., Li J., Liang C., Chen J., Li Y., Chen X, & Cao W. (2021). Mutual regulation between chicken telomerase reverse transcriptase and the Wnt/β-catenin signalling pathway inhibits apoptosis and promotes the replication of ALV-J in LMH cells. Veterinary Research, 52, 110.
+ Open protocol
+ Expand
8

Esophageal Cancer Cell Lines: Cultivation and POU5F1B Inhibition

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human esophageal cancer cell lines (ECA109, ECA9706, KYSE410, and KYSE510) and a normal esophageal epidermis cell line (HEEPIC) were purchased from ATCG and cultured in RPMI-1640 medium (10% FBS). The atmosphere of the culture chamber kept at 37°C and 5% CO2. Pancreatic enzymes were used to digest cells at cell fusion of 85%. RPMI-1640 medium was from Gibco (USA), 0.1% crystal violet staining solution was from Solarbio (USA), and cell culture flasks and culture plates were acquired from Corning (USA). The inhibitor of POU5F1B (GAAGAGTTCCTAACACATTCA) was synthesized by GenePharma (China), Lipofectamine 2000 and Trizol were purchased from Invitrogen (USA), the RT-PCR kit was bought from Takara (Japan), and the penicillin-streptomycin, trypsin-EDTA solution, cell cycle kit, apoptosis assay kit, and annexin V-FITC apoptosis detection kit were from Beyotime Biotechnology (China).
Meng B., Xing Y., Li H., Gao F, & Liu Y.C. (2019). Knockdown of Long Noncoding RNA POU5F1B Promotes Radiosensitivity in Esophageal Carcinoma. Medical Science Monitor : International Medical Journal of Experimental and Clinical Research, 25, 1214-1219.
+ Open protocol
+ Expand
9

Cell Cycle Analysis by Flow Cytometry

Check if the same lab product or an alternative is used in the 5 most similar protocols
The cell cycle was determined in strict accordance with the instructions of the cell cycle kit (Beyotime, Shanghai, China). CCs (5 × 105 cells/well) were seeded in 6-well plates. After the cells adhered, they were treated with 0 μM BLM-NC or 200 μM BLM for 3 h, trypsinized, and collected into 1.5 mL centrifuge tubes. Cells were resuspended in 100 μL of PBS after centrifugation at 500× g for 5 min. The cell cycle distribution was detected using a flow cytometer (Beckman Coulter, Brea, CA, USA), and the data were processed using MODFIT software (Verity Software House, Topsham, ME, USA).
Liu J.B., Zhang J.B., Yan X.M., Xie P.G., Fu Y., Fu X.H., Sun X.L., Han D.X., Li S.P., Zheng Y., Gao Y., Kim N.H., Yuan B, & Jiang H. (2023). DNA Double-Strand Break-Related Competitive Endogenous RNA Network of Noncoding RNA in Bovine Cumulus Cells. Genes, 14(2), 290.
+ Open protocol
+ Expand
10

Cell Cycle Analysis of Transfected Cells

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Cancer cells were digested and resuspension, and washed twice with PBS after cells transfected with siRNA for 72 h. Cells were fixed with 70% precooled ethanol at 4°C for 1 day. The next day, the cells were washed three times with PBS, then stained with Cell Cycle Kit (Beyotime, China, C1052) (25 (link)). The cells were then analyzed by a flow cytometry (Beckman Coulter Quanta SC System).
Jiang S., Deng X., Luo M., Zhou L., Chai J., Tian C., Yan Y, & Luo Z. (2023). Pan-cancer analysis identified OAS1 as a potential prognostic biomarker for multiple tumor types. Frontiers in Oncology, 13, 1207081.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!