Quantitect rt kit

Manufactured by Qiagen

Sourced in Germany, United States, United Kingdom, Canada, Netherlands

The QuantiTect RT kit is a reagent kit designed for reverse transcription of RNA to cDNA. It includes a reverse transcriptase enzyme, necessary buffers, and other components required for the conversion of RNA to complementary DNA.

Automatically generated - may contain errors

Lab products found in correlation

187 protocols using quantitect rt kit

Quantitative RT-PCR Analysis of MTH1 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA (1 μg) from tumor and matched normal tissues prepared as described in section 2.4 was reverse transcribed into cDNA using the Qiagen Quantitect RT kit according to manufacturer’s protocol. RT-qPCR was performed in triplicate in a 5 μl reaction using Maxima® Probe/ROX qPCR Master Mix (Fermentas) with 0.05 μg of cDNA and MTH1 specific primers (MTH1 Forward: CTCAGCGAGTTCTCCTGG; MTH1 Reverse: GGAGTGGAAACCAGTAGCTGTC) or GAPDH specific primers (GAPDH Forward: AGCCACATCGCTCAGACAC; GAPDH Reverse: GCCCAATACGACCAAATCC) as an internal control. Samples were run on an ABI QuantStudio 12K Flex instrument using 1 cycle at 50°C for 2 min, 95°C for 10 min followed by 40 cycles of 95°C for 15 sec, 60°C for 1 min and a melt curve of 95°C for 15 sec, 60°C for 1 min, 95°C for 15 sec. Data from 3 separate experiments were analyzed using the delta Ct method and the mean from these experiments is reported.

McPherson L.A., Troccoli C.I., Ji D., Bowles A.E., Gardiner M.L., Mohsen M.G., Nagathihalli N.S., Nguyen D.M., Robbins D.J., Merchant N.B., Kool E.T., Rai P, & Ford J.M. (2019). Increased MTH1-specific 8-oxodGTPase activity is a hallmark of cancer in colon, lung and pancreatic tissue. DNA repair, 83, 102644.

+ Open protocol

+ Expand

Analyzing Allelic Expression of PIGY Gene

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from 2.5 ml of blood using the PAXgene kit (Qiagen) and Reverse Transcriptase (RT) reactions were performed using the QuantiTect RT kit (Qiagen). Relative allelic expression of PIGY was measured by analysing cDNA using both Sanger sequencing and a 314 chip run on the Ion Torrent PGM platform. As the c.-540G>A variant is only 4 bp from the transcription start site, expression levels had to be measured indirectly using the T allele at rs3177413 (c.-222C>T) which familial transmission showed was in cis with c.-540G>A allele. RT-PCR primer sequences are shown in Table 1. The first round of amplification (25–30 cycles) and second round of amplification (15 cycles, with barcoding primers) were both performed with the FastStart Taq DNA polymerase kit (Roche). Samples were pooled, cleaned using Ampure beads, quantified using the BioAnalyser (Agilent) and diluted to 10 pM. Emulsion PCR and sequencing were carried out according to manufacturer instructions.
Quantitative PCR was performed using IQ SYBR Green Supermix (BIO-RAD) and the iQ5 Real-Time PCR Detection System (BIO-RAD) and the following primers: PIGY-V5-F 5′-AGGGATGTTCATCTCCAACCA-3′, PIGY-V5-R 5′-TGCGCATATCAGGCTTAGGA-3′, RPL30-F 5′-CAGACAAGGCAAAGCGAAAT-3′ and RPL30-R 5′-TGGACACCAGTTTTAGCCAAC-3′. PCRs were performed in triplicate, and the experiment was carried out three times.

Ilkovski B., Pagnamenta A.T., O'Grady G.L., Kinoshita T., Howard M.F., Lek M., Thomas B., Turner A., Christodoulou J., Sillence D., Knight S.J., Popitsch N., Keays D.A., Anzilotti C., Goriely A., Waddell L.B., Brilot F., North K.N., Kanzawa N., Macarthur D.G., Taylor J.C., Kini U., Murakami Y, & Clarke N.F. (2015). Mutations in PIGY: expanding the phenotype of inherited glycosylphosphatidylinositol deficiencies. Human Molecular Genetics, 24(21), 6146-6159.

+ Open protocol

+ Expand

Quantifying Antiviral Gene Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using the NucleoSpin RNA kit (Macherey-Nagel)
according to the manufacturer’s protocol. cDNA was synthesized from 1
μg total RNA using the QuantiTect RT kit (Qiagen) according to
manufacturer’s instructions. qPCR was carried out using the ViiA7 qPCR
system with TaqMan reagents using TaqMan
primers/probes (Life Technologies) for IFNB,
IFNL1, ISG15, IFIT1,
MX1, OAS1, TNFA,
IL6, ZC3HAV1, CSTF2,
HPRT, GAPDH and custom-designed,
isoform-specific probes for ZAP-S and ZAP-L (Supplementary Table 1).
TaqMan primers/probes for IFNL2 and
IFNL3 were previously designed and tested for
specificity^{6 (link), 41}. Target gene expression was normalized
to HPRT or GAPDH housekeeping genes.

Schwerk J., Soveg F.W., Ryan A.P., Thomas K.R., Hatfield L.D., Ozarkar S., Forero A., Kell A.M., Roby J.A., So L., Hyde J.L., Gale M J.r., Daugherty M.D, & Savan R. (2019). RNA-binding protein isoforms ZAP-S and ZAP-L have distinct antiviral and immune resolution functions. Nature immunology, 20(12), 1610-1620.

+ Open protocol

+ Expand

Polysome Profiling of ZAP-Mediated Antiviral Response

Check if the same lab product or an alternative is used in the 5 most similar protocols

1×10⁷ Huh7 ZAP KO cells were grown on 15 cm dishes and
transfected with plasmids expressing ZAP-S, ZAP-L or empty vector (EV) control.
24 h after plasmid transfection, cells were stimulated with 250 ng/ml poly U/UC
RNA for 18 h. Cells were then incubated with 100 μg/ml cycloheximide
(Sigma) in PBS for 5 min at 37 °C with 5% CO₂. Cells were
washed twice in ice-cold PBS and harvested in 500 μl polysome lysis
buffer (50 mM Tris-HCl pH 7.5, 100 mM KCl, 12 mM MgCl₂, 1% NP-40, 1
mM DTT, 1x HALT protease inhibitor, 100 μg/ml cycloheximide). The lysate
was cleared of nuclei and debris by centrifugation at 8,000 × g for 10
min at 4 °C. Supernatants were layered on a 10–50% sucrose
gradient and spun at 230,000 × g for 2.5 h at 4 °C. Gradients were
then fractionated while continuously monitoring absorbance at 254 nm. Total RNA
was isolated from the fractions using TRIzol and the Direct-zol 96 RNA kit (Zymo
Research) according to the manufacturer’s instructions. cDNA was
synthesized from 1 μg total RNA using the QuantiTect RT kit (Qiagen)
according to manufacturer’s instructions. qPCR was carried out using the
ViiA7 qPCR system with TaqMan reagents using
TaqMan primers/probes (Life Technologies) for
IFNB and HPRT.

+ Open protocol

+ Expand

ABC-B1 Gene Expression Profiling in STEMs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Gene expression levels of ATP-binding cassette (ABC) sub family B member 1 (ABC B1) in STEMs were measured using real time RT-qPCR at the end of day 15. For 2-D samples, the three cell types were cultured together and RNA isolation was performed at 60–70 % confluency using RNAeasy mini kit (QIAGEN), followed by cDNA synthesis by using 250 ng of RNA (Quantitect RT kit, Qiagen). Expression of ABC-B1 was normalized using 18 s rRNA. The sequence of the primers were as follows: ABC-B1: Forward: CAGAGGGGATGGTCAGTGTT; Reverse: CCTGACTCACCACACCAATG; 18srRNA: Forward: CCTGCGGCTTAATTTGACTC; Reverse: AACTAAGAACGGCCATGCAC (n = 4).

Lamichhane S.P., Arya N., Kohler E., Xiang S., Christensen J, & Shastri V.P. (2016). Recapitulating epithelial tumor microenvironment in vitro using three dimensional tri-culture of human epithelial, endothelial, and mesenchymal cells. BMC Cancer, 16, 581.

+ Open protocol

+ Expand

Quantitative PCR Analysis of Rat DRG

Check if the same lab product or an alternative is used in the 5 most similar protocols

Ipsilateral L4/L5 DRGs from rats or mice were rapidly dissected, and frozen in RNA Later reagent (Qiagen). Total RNA was extracted using RNeasy Mini Kit (Qiagen, Basel, Switzerland) and RNA quality control tested using the RNA 6000 Nano LabChip technology (Agilent). RNA was then reverse transcribed using Omniscript reverse transcriptase or Quantitect RT Kit according to the manufacturer’s protocol (Qiagen). Quantitative real-time PCR was performed using SYBR-green qPCR with the MyiQ Single Color real-time PCR System or CFX96 Real-Time System (Bio-Rad, Reinach, Switzerland). Primer sets (Suppl. Table 4) were designed on OligoArchitect™ Online v3.0 (Sigma-Aldrich website). Specific PCR product amplification was confirmed using dissociation protocol and melting curve. All experiments were done at least in duplicate. Fold changes were determined using the relative standard curve method per the manufacturer’s instructions (Bio-Rad). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as housekeeping gene since its expression in DRG is not altered by SNI surgery^{64 (link)}.

Berta T., Perrin F.E., Pertin M., Tonello R., Liu Y.C., Chamessian A., Kato A.C., Ji R.R, & Decosterd I. (2017). Gene Expression Profiling of Cutaneous Injured and Non-Injured Nociceptors in SNI Animal Model of Neuropathic Pain. Scientific Reports, 7, 9367.

+ Open protocol

+ Expand

RT-qPCR Protocol following MIQE Guidelines

Check if the same lab product or an alternative is used in the 5 most similar protocols

RT-qPCR was performed following MIQE guidelines as described in supplement (Bustin et al., 2009 (link)). Briefly, RNA was extracted with Trizol and reverse transcribed with the Quantitect RT kit (Qiagen) according to the included instructions. qPCR reactions were run on an ABI 7900 (Life Technologies) using iTaq Universal Sybr Green Master mix (Bio-Rad). Primer sequences are made available in the RTPrimerDB (http://www.rtprimerdb.org/)(Pattyn et al., 2003 (link)) and primer ID numbers are listed in Supplementary Table 1. RT-qPCR data was standardized and analyzed before statistical analysis as described previously (Willems et al., 2008 (link)).

Cabral-Teixeira J., Martinez-Fernandez A., Cai W., Terzic A., Mercola M, & Willems E. (2015). Cholesterol-derived glucocorticoids control early fate specification in embryonic stem cells. Stem cell research, 15(1), 88-95.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RT-qPCR analysis was carried out according to a method described previously [11 (link)]. In brief, the total RNA obtained from each tissue was reverse transcribed using the QuantiTect RT kit (Qiagen, Cat. no. 205311). To assess the levels of gene expression, RT-qPCR was conducted using a real-time PCR system (Applied Biosystems ViiA 7) and SYBR Green as the double-stranded DNA-specific fluorescent dye (Bio-Rad, Cat. no. 1708880, Supplementary Table 2). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal control to normalize the RT-qPCR efficiency and quantify the gene expression levels. RT-qPCR was performed on each sample independently and in triplicate.

Choi Y.J., Kim E., Reza A.M., Hong K., Song H., Park C., Cho S.K., Lee K., Prather R.S, & Kim J.H. (2017). Recombination activating gene-2null severe combined immunodeficient pigs and mice engraft human induced pluripotent stem cells differently. Oncotarget, 8(41), 69398-69407.

+ Open protocol

+ Expand

ATF2 Knockdown Alters DNA Methylation

Check if the same lab product or an alternative is used in the 5 most similar protocols

ATF2 knockdown was performed as described and DNA/RNA was extracted using the DNeasy/RNeasy kits (Qiagen, Crawley, UK), respectively. Total RNA was reverse transcribed using the Quantitect RT kit (Qiagen, Crawley, UK). Pyrosequencing primers were designed using Pyromark Assay Design 2.0 software (Qiagen, Crawley, UK) to measure the DNA methylation levels of ESR1 and PGR after ATF2 knockdown and synthesised by Eurofins MWG Operon (Ebersberg, Germany). The primer sequences are listed in Supplementary Material and Methods, Table 3. Genomic DNA was treated with sodium bisulphite using the EZ DNA methylation Kit (Zymo Research, CA, USA). PCR amplifications were performed in a final volume of 25 μl using HotStarTaq Master Mix (Qiagen, Crawley, UK), 200 nM biotinylated primer, 400 nM non-biotinylated primer and 60 ng of bisulfite-treated genomic DNA. The thermal profile was 95 °C for 5 min followed by 40 cycles of denaturation at 94 °C for 30 s, annealing at 51–56 °C for 30 s and extension at 72 °C for 30 s. The PyroMark Gold Q96 SQA Reagents and the PyroMark Q96 ID instrument (Qiagen, Crawley, UK) were used for pyrosequencing analysis following the supplier’s protocol. The methylation index for each promoter was calculated as the mean value of mC/(mC + C), where C is unmethylated cytosine and mC is 50′ methyl-cytosine, for all examined CpGs in the target sequence.

Giannoudis A., Malki M.I., Rudraraju B., Mohhamed H., Menon S., Liloglou T., Ali S., Carroll J.S, & Palmieri C. (2020). Activating transcription factor-2 (ATF2) is a key determinant of resistance to endocrine treatment in an in vitro model of breast cancer. Breast Cancer Research : BCR, 22, 126.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Extracted RNA was reverse transcribed using the QuantiTect RT kit (Qiagen, for total RNA) or miRCURY RT kit (Qiagen, for small RNAs) according to manufacturer's instructions. The resulting cDNA was diluted as per kit instructions and quantified with specific primers (Supplementary Table S9) using either QuantiNova SYBR green assays (Qiagen, for cDNA from total RNA) or miRCURY SYBR green assays (Qiagen, for cDNA from small RNAs). Small RNA miRCURY qPCR primer assays were purchased from Qiagen. Primers for the PSG lncRNA were designed to match the PSG lncRNA perfectly but have a mismatch at the 3′ end to the parental ZFAND5 gene. Mismatches located in the 3′ end were shown to impair PCR amplification (21–23 (link)) and allow for differentiation between PSG lncRNA and parental gene. ZFAND5 parental gene primers are located in exon 6 (forward primer) and exon 7 (reverse primer), which according to our data are not expressed at the PSG locus and should only amplify mature mRNA. Data were analysed using the 2^−ΔΔCt method (24 (link)).

Ressel S., Kumar S., Bermúdez-Barrientos J.R., Gordon K., Lane J., Wu J., Abreu-Goodger C., Schwarze J, & Buck A.H. (2024). RNA–RNA interactions between respiratory syncytial virus and miR-26 and miR-27 are associated with regulation of cell cycle and antiviral immunity. Nucleic Acids Research, 52(9), 4872-4888.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!