RNAzol (Sigma-Aldrich, USA) was used for RNA isolation from H1993 and H1581 cells (106 cells) or tissues (about 0.025 g tissues in 0.5 ml RNAzol reagent). DNase I digestion was performed on all RNA samples. Following that, reverse transcriptions were performed to synthesize cDNAs. With cDNAs as a template, qPCRs were performed to detect the expression of WT1-AS and UCA with 18S rRNA as the endogenous control. Three technical replicates were included in each experiment and Ct values of targeted genes were normalized to 18S rRNA using the 2-ΔΔCT method. The primer sequences were: WT1-AS Forward: 5′-GAGGACAGA GAGGCATGGAG-3′; Reverse: 5′-ACCCCTAGGCAAGGAGAAGA-3′; UCA1 Forward: 5′-ACGCTAACTGGCACCTTGTT-3′; Reverse: 5′-TGGGGATTACTGGGGTAGGG-3′; 18S rRNA Forward: 5′-CGGCTACCACATCCAAGGAA-3′; Reverse: 5′-TGTCACTACCTCCCCGTGTCA-3′.
Rnazol
Manufactured by Merck Group
Sourced in United States, Germany, China, India, United Kingdom
RNAzol is a reagent used for the isolation and purification of RNA from various biological samples, such as cells, tissues, and bodily fluids. It is a single-step method that utilizes a mixture of guanidinium thiocyanate and phenol to effectively separate RNA from DNA, proteins, and other cellular components.
Automatically generated - may contain errors
Lab products found in correlation
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (11 mentions)
Dnase 1, by Thermo Fisher Scientific (11 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (7 mentions)
All in one mirna qrt pcr detection kit, by GeneCopoeia (7 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (6 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (6 mentions)
Taqman probe, by Thermo Fisher Scientific (4 mentions)
Quantitect sybr green pcr kit, by Qiagen (4 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (4 mentions)
Maxima sybr green qpcr mix, by Thermo Fisher Scientific (3 mentions)
Turbo dna free kit, by Thermo Fisher Scientific (3 mentions)
Primescript rt reagent kit, by Takara Bio (3 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (3 mentions)
Iscript cdna synthesis kit, by Bio-Rad (2 mentions)
Sybr green master mix, by Bio-Rad (2 mentions)
Rneasy kit, by Qiagen (2 mentions)
Tetro reverse transcriptase, by Meridian Bioscience (2 mentions)
Quantitect reverse transcription kit, by Qiagen (2 mentions)
Primescript reverse transcriptase kit, by Takara Bio (2 mentions)
Mirna universal sybr qpcr master mix, by Vazyme (2 mentions)
101 protocols using rnazol
1
Quantification of lncRNA Expression
2
Mitochondrial Dynamics in Myotube Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from myotubes was extracted by RNAzol (Merck Life Sciences, Milan, Italy). The RNA was retrotranscribed with high-capacity cDNA Reverse Transcription Kit (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA), and real-time PCR was performed with the StepOnePlus Real-time PCR System (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA), using the following TaqMan probes (Thermo Fisher Scientific, Waltham, MA, USA): Opa1 (Mm00453873_m1), Mff (Mm01273401_m1), Mfn2 (Mm00500120_m1), FbxO32 (Atrogin-1, Mm00499523_m1), Trim63 (MuRF-1, Mm01185221_m1), and Gusb (Mm01197698_m1).
3
Hatchling RNA Extraction and qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For each experimental group, total RNA was extracted from 5 different hatchlings (N = 5) using RNAzol (Merck, Darmstad, Germany) as previously described in [28] (link). Briefly, each hatchling was homogenized using an Ultra-Turrax homogenizer (IKA-Werke GmbH & Co., Staufen, Germany), total RNA was extracted according to the standard protocol, and genomic DNA contamination was removed with DNase I digestion. RNA was then run on 1% agarose gel to verify its quality and quantified using a nanodrop spectrophotometer (NanoPhotometer™ P-Class, IMPLEN, München, Germany). Moreover, 5 µg of total RNA was used for cDNA synthesis, using Iscript cDNA synthesis kit (Biorad, Milan, Italy).
The qRT-PCRs were performed with the SYBR green method in a CFX thermal cycler (Bio-rad, Milan, Italy) as previously described in [29] (link). For each experimental group, replicates (N = 5) were run in duplicate. The final primer concentration was 10 pmol/µL. β tubulin (βtub) mRNA and 18S RNA were selected using NormFinder (V0.953) [30] (link) and used to normalize target gene expression levels analyzed by CFX Manager Software version 3.1 (Bio-Rad, Hercules, CA, USA), including GeneEx Macro Conversion and GenEx Macro files, and the results are represented by bar plots along with the standard deviation. The primer sequence is shown in Table 1.
The qRT-PCRs were performed with the SYBR green method in a CFX thermal cycler (Bio-rad, Milan, Italy) as previously described in [29] (link). For each experimental group, replicates (N = 5) were run in duplicate. The final primer concentration was 10 pmol/µL. β tubulin (βtub) mRNA and 18S RNA were selected using NormFinder (V0.953) [30] (link) and used to normalize target gene expression levels analyzed by CFX Manager Software version 3.1 (Bio-Rad, Hercules, CA, USA), including GeneEx Macro Conversion and GenEx Macro files, and the results are represented by bar plots along with the standard deviation. The primer sequence is shown in Table 1.
4
Borrelia burgdorferi RNA Isolation and qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
B. burgdorferi cultures were pelleted at 4°C, 3,200 x g for 20 minutes. Cell pellets were washed once with HN buffer (10 mM HEPES, 10 mM NaCl, pH 8.0). RNA isolation was performed using RNAzol (Sigma-Aldrich, St. Louis, MO, United States) according to kit instructions. The RNA was quantified by spectrophotometry using a TAKE3 plate in a Cytation 5 multi-mode plate reader (Biotek, Winooski, VT, USA), and RNA quality was assessed by analysis of ribosomal RNA bands visualized following gel electrophoresis by SYBR-safe dye incorporation. cDNA was generated from 500 ng of total RNA from each sample with the High Capacity cDNA Reverse Transcriptase kit (Applied Biosystems, Foster City, CA, United States) following kit instructions. RT-qPCR was performed on the cDNA in the CFX Connect Real-Time PCR Detection System (Bio-Rad, Hercules, CA, United States) using Bullseye EvaGreen Master Mix (MIDSCI, St. Louis, MO, United States) reagents and oligonucleotide primers targeting the gene of interest (S1 Table ). The RT-qPCR data were analyzed using the ΔCq method to indicate copies per 16S rRNA transcript levels.
5
RNA Isolation and Sequencing Protocol
6
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using RNazol (Sigma, St. Louis, MO, USA) according to the manufacturer’s instructions. RNA (500 ng) per sample was cleaned from residual gDNA by Turbo DNA-free kit (Ambion, Austin, TX, USA) and reverse transcribed using RevertAID First Strand cDNA Synthesis Kit (Thermo Fisher Scientific). Diluted cDNA was subjected to quantitative real-time PCR analysis using Maxima SYBR Green qPCR Mix (Thermo Fisher Scientific) and the three-step cycling protocol on the StepOne Plus Real-Time Thermal Cycler (Applied Biosystems, Foster city, CA, USA). Relevant primers were designed against the selected genes (Table S1 ). qPCR analysis was performed in triplicates and in two different experiments with similar results. The expression data were analyzed by normalizing each sample to the GAPDH expression.
7
RNA Isolation Using RNAzol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To isolate RNA with high quality, samples were mixed with RNAzol (Cat# R4533, Sigma-Aldrich) at 10:1 ratio (volume) and incubated at room temperature for 40 min. The mixtures were centrifuged at 12,000 g for 10 min to collect the supernatants. The supernatants were mixed with chloroform at 4:1 ratio (volume) and centrifuged at 12,000 g for 10 min. The supernatants were collected, mixed with methanol at 1:1 ratio (volume), and centrifuged at 12,000 g for 10 min. The RNAs in the supernatants were precipitated, washed three times with 70% ethanol, and resuspended in nuclease-free water.
8
Detecting BRSV RNA via RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time reverse transcription polymerase chain reaction (RT-PCR) was performed on nasal secretion samples as previously described [13 (link)]. Briefly, nasal secretion sample aliquots were subjected to RNA extraction using RNAzol® (Sigma-Aldrich, St. Louis, MO, USA) following manufacturers recommendations. Once extracted, the RNA templates were reverse transcribed and amplified with qScript™ XLT One-Step RT-qPCR ToughMix (Quantabio®, Beverly, MA, USA) using BRSV specific primers and probes [13 (link)]. Each reaction (2.5 μL) was performed in a BioRad CFX96® (Bio-Rad®, Hercules, CA, USA) and results were analyzed by BioRad CFX manager® (Bio-Rad®, Hercules, CA, USA). The detection limit of the assay was established at 101 BRSV RNA copies/μL.
9
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Frozen lungs were ground to powder using pre-cooled mortar and pestle, and re-suspended in RNAzol (Sigma-Aldrich, Darmstadt, Germany). Total RNA was extracted following the manufacturer’s protocol. Reverse transcription was realized using PrimeScript 1st strand cDNA synthesis kit (Takara Bio Inc., Kusatsu, Shiga, Japan). qPCR was performed using a Corbett Rotor-Gene 6000 apparatus and Rotor-Gene SYBR Green PCR kit (QIAGEN, Hilden, Germany). Primers were: 5s-6as and 5f-6r55 (link). Program was: 45 cycles of 20 sec at 95 °C, 30 sec at 57 °C for 5s-6as/59 °C for 5f-6r and 60 sec at 72 °C. qPCR samples were run on 2% agarose gels containing GelRed Nucleic Acid Gel Stain (Biotium Inc., Fremont, CA, USA) and visualized on a UV table. For mRNA expression analyses, primers used are shown in Supplementary Table SI . Program was a standard 2-steps program with 40 cycles of 5 sec denaturation at 95 °C and 10 sec annealing/amplification at 60 °C.
10
Quantifying mRNA Levels by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cellular RNA was extracted with RNAzol (Sigma-Aldrich, R4533) according to manufacturer’s protocol, and cDNA was synthesized from 1 ug RNA (Applied Biosystems, #4374966). cDNA was diluted 1:10 and assessed for mRNA transcript levels by qPCR with SYBR Green Mix (Applied Biosystems, #A25741) on a QuantStudio7 Flex Real-Time PCR System (Thermo Fisher). Oligonucleotide primer sequences for target and reference genes are as follows: human_ACTIN (forward: AAGTCCCTCACCCTCCCAAAAG, reverse: AAGCAATGCTGTCACCTTCCC), human_GAPDH (forward: AACCTGCCAAGTATGATGACATCA, reverse: TGTTGAAGTCACAGGAGACAACCT), human_OPRM1 (forward: ACTGATCGACTTGTCCCACTTAGATGGC, reverse: ACTGACTGACTGACCATGGGTCGGACAGGT), mouse_GAPDH (forward: AACGACCCCTTCATTGACCT, reverse: TGGAAGATGGTGATGGGCTT), mouse_L30 (forward: ATGGTGGCCGCAAAGAAGACGAA, reverse: CCTCAAAGCTGGACAGTTGTTGGCA), mouse_OPRM1 (forward: CTGCAAGAGTTGCATGGACAG, reverse: TCAGATGACATTCACCTGCCAA), YFP (forward: TGCTTCGCCCGCTACCC, reverse: ATGTTGCCGTCCTCCTTGAAG). The fold change in the target mRNA abundance, with respect to SH-SY5Y cells and normalized by the reference gene GAPDH, was calculated using the 2−ΔΔCT method101 (link).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!