Full-length rat cortactin cDNA subcloned in pDsRed1-N1 or pEGFP-N1 (Clonetech) were provided by Dr M.A. McNiven (Mayo Clinic, Rochester, MI, USA). cDNA encoding ARF6T157N (a gift from Dr M. Franco, Univ Sophia-Antipolis, France) was inserted in a pDEST WPI lentiviral expression vector (a kind gift from P. Benaroch, Institut Curie, Paris) through Gateway Cloning technology (Invitrogen). C-terminally GFP-tagged ARF6T157N construct was obtained by subcloning ARF6T157N cDNA into a pEGFP-N1 vector (Clontech). N-terminally-GFP tagged Rac1G12V was a gift from P. Fort (CRBM, Montpellier, France). For transient expression, MDA-MB-231 cells were transfected with plasmid constructs (1 μg) by using Lipofectamine LTX (Invitrogen) or Nucleofector (Lonza) according to the manufacturer’s instructions. Cells were analyzed 48 h after transfection.
Pdsred1 n1
Manufactured by Takara Bio
Sourced in United States
PDsRed1-N1 is a fluorescent protein derived from the sea anemone Discosoma sp. red fluorescent protein. It is designed for use as a red fluorescent protein marker in living cells and tissues.
Automatically generated - may contain errors
Lab products found in correlation
Pegfp n1, by Takara Bio (2 mentions)
Pdsred er, by Takara Bio (2 mentions)
Quikchange site directed mutagenesis kit, by Agilent Technologies (2 mentions)
Pegfp n1 vector, by Takara Bio (1 mentions)
Gateway cloning technology, by Thermo Fisher Scientific (1 mentions)
Lipofectamine ltx, by Thermo Fisher Scientific (1 mentions)
Pgex 4t 1, by GE Healthcare (1 mentions)
Pegfp n2, by Takara Bio (1 mentions)
Pcdna3.1 myc his, by Thermo Fisher Scientific (1 mentions)
Pdsred monomer golgi, by Takara Bio (1 mentions)
Pecerulean c1, by Takara Bio (1 mentions)
Peyfp c1, by Takara Bio (1 mentions)
Pegfp n3 vector, by Takara Bio (1 mentions)
Quikchange, by Agilent Technologies (1 mentions)
8 protocols using pdsred1 n1
1
Overexpression of Cortactin and ARF6 Mutants in MDA-MB-231 Cells
2
RUNX2 cDNA Cloning and Mutagenesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
WT RUNX2 cDNA (NM_001024630.3 ) was commercially obtained from Genecopoeia, USA (H5214). WT, site-specific S118A, R115A and deletion mutants; 1–140, 1–140 S118A, 141–521 of RUNX2 were generated and sub-cloned into glutathione-S-transferase (GST)-tagged vector pGEX-4T1 (GE Health Care) for bacterial expression. Whereas, RUNX2-WT, site-directed mutants of S118A, S118D and R115A were cloned into pDsRed1-N1 (Clonetech, USA) containing red fluorescent protein for mammalian expression. List of primers used for real-time PCR (RT-PCR) analysis and site-directed mutagenesis are given in Supplementary Table S1 .
3
Cloning and Expression of Human CRP and Ref-1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human CRP cDNA (GeneBank accession No. NM_000567) was PCR amplified using a pair of specific primers, 5′‐TGAATTCAGGCCCTTGTATC‐3′ (sense) and 5′‐TCCCAGCATAGTTAACGAGC‐3′ (antisense) and human Ref‐1 (GeneBank accession No. NM_001641) was PCR amplified by specific primers, 5′‐AAGCTTGAGTCAGGACCCTT‐3′ (sense) and 5′‐AAGGAATGGTAGTTGAGGGG‐3′ (antisense), for cloning. The complete nucleotide sequences were cloned into the pcDNA3.1 expression vector (CRP‐pcDNA3.1) (Invitrogen) and were sub‐cloned into the pEF1α‐Myc, pDsRed1‐N1 and pEGFP‐N2 vectors (Clontech Laboratories, Inc.).
4
Generating Mutant GJB1 Expression Plasmids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The full‐length coding region of human GJB1 was cloned into pcDNA3.1/myc‐His (Invitrogen, Grand Island, NY) to generate wild‐type (WT) GJB1 expression plasmids. The GJB1 mutations identified in this study were separately introduced into the WT expression plasmids using a QuikChange Site‐Directed Mutagenesis Kit according to the manufacturer's recommendations (Agilent, Santa Clara, CA). The transfection marker pDsRed1‐N1, the endoplasmic reticulum marker pDsRed‐ER, and the Golgi marker pDsRed‐Monomer‐Golgi were all purchased from Clontech (Mountain View, CA).
5
Plasmids Encoding RhoA and KRAS
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmids encoding the RhoAT19N mutant (plasmid no. 12967) were purchased from Addgene. KRAS WT, KRAS G12V and KRAS G12D were subcloned into pDsRed1-N1 (CLONTECH, catalog no. 921-1).
6
Kv1.3 Channel Constructs and Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
T.C. Holmes (University of California, Irvine, CA) provided the rat Kv1.3 in a pRcCMV construct. The channel was subcloned into pEYFP-C1 and pECerulean-C1 (Clontech). All Kv1.3 mutants were generated in the pEYFP-Kv1.3 channel using a QuikChange site-directed mutagenesis kit (Agilent Technologies). pEYFP-Kv1.3CBDless was subcloned into pECerulean-C1. For oocyte injection, Kv1.3 and Kv1.3CBDless were subcloned into pcDNA3 and were placed under the control of a T7 promoter and then the cRNA was synthetized. J.R. Martens (University of Florida Medical School) provided the rat Caveolin 1 (Cav1) in pECerulean-C1. Cav1 was cloned into pcDNA3. The plasma membrane marker Akt-PH-pDsRed (pDsRed-tagged pleckstrin homology (PH) domain of Akt) was a kind gift of F. Viana (Universidad Miguel Hernández, Spain). The ER marker (pDsRed-ER) was obtained from Clontech. The mitochondrial marker (pmitoRFP) was constructed by fusing the mitochondrial transit sequence of the human isovaleryl coenzyme A dehydrogenase to the N-terminus of RFP (pDsRed1-N1, Clontech). Constructs were verified by sequencing.
7
Cloning and Construction of TRIM34 Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human TRIM34 cDNAs were obtained by RT-PCR from HeLa cells stimulated by INFα and cloned into pEGFP-N3 vector (Clontech) using XhoⅠ and HindⅢ restriction enzymes. For construction of the 5′FLAG-pcDNA3.1-TRIM34 vector, TRIM34 cDNA fragment was subcloned at the ClaⅠ and XhoⅠ sites into 5′FLAG-pcDNA3.1 vector (Invitrogen). Human TRIM34 or TRIM22 cDNAs were also subcloned into the XhoⅠ/HindⅢ sites of pDsRed1-N1 (Clontech) respectively. The constructs described here were verified by sequencing. The pEGFP-LC3B-h vector was purchased from Wuhan Miaoling Bioscience & Technology.
8
Cloning of DJ-1 and DJBP Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A full-length FLAG-tagged DJ-1 sequence was cloned into the KpnI and XhoI sites of the pcDNA3.1+ vector to generate pcDNA3-FLAG-DJ-1. The DJBP cDNA encoding the 570 amino acid isoform (AB073862) was amplified from human whole-brain cDNA (Clontech) using specific oligonucleotide primers (Supplementary Table S1 ) and cloned into the BamHI and XbaI sites of pRK5myc to generate pRK5myc-DJBP(570). Sequences encoding amino acids 1–31 and 1–48 of full-length DJBP/EFCAB6 (NM_022785.3) were amplified from a DKFZ clone (DKFZp686C1630Q; RZPD German Resource Center for Genome Research) using specific oligonucleotide primers (Supplementary Table S1 ) and cloned into the XhoI and BamHI sites of pEGFP-N1 (Clontech) in-frame with EGFP. The mitochondrial targeting sequence from human cytochrome c oxidase subunit VIII A (NM_004074.2) was amplified from human frontal cortex cDNA (Clontech) using specific oligonucleotide primers (Supplementary Table S1 ). An EcoRI/BamHI fragment was cloned into the MCS of pDsRed1-N1 (Clontech) to generate pDsRed1-MTS. DJ-1 missense mutations were introduced into plasmid constructs by PCR-mediated site-directed mutagenesis (QuikChange, Agilent) using pairs of complementary oligonucleotide primers (Supplementary Table S2 ).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!