Anti zo 1

Western blotting analyses were performed using the following antibodies: anti PI3K-C2α, anti PI3K-C2β (BD Transduction Laboratories); anti p110β, anti p110α, anti pERK1-2 (Thr202-Tyr204), anti pMEK1-2 (Ser217-221), anti PTEN, anti TCF8/ZEB1, anti ZO-1, anti β catenin, anti Vimentin, anti Claudin-1, anti Slug (Cell Signaling Technology); anti Tubulin, anti ERK2, anti Actin (Santa Cruz Biotechnology); anti GAPDH (Abcam); anti-rabbit IgG, anti-mouse IgG (Sigma Aldrich, UK). Transient downregulation of enzymes of interest was obtained using the following siRNAs: PI3K-C2β (sequence 1): AAGAATGCGACGCCTGGCAAG (Qiagen); PI3K-C2β (sequence 2): Cat. No. J-006772-08 (Dharmacon); p110β (Dharmacon, smartpoolA); Slug: Cat. No. J-017386-05 (Dharmacon). Non-targeting siRNAs (Ambion or Dharmacon), designated as ‘si NC’, were used as control.

Total proteins were extracted by the Cell Lysis Buffer (Beyotime, China). The protein quantification from the total extracted cell protein lysates was detected by the BCA protein assay, then the same 10 μg of protein samples were separated by the SDS-PAGE and transferred onto PVDF membranes. The proteins on the membrane were then blocked with 5% skim milk for 30 min and incubated overnight at 4 °C with anti-E-Cadherin (#20874-1-AP, Proteintech, China, 1:5000), anti-MMP2 (#10373-2-AP, Proteintech, China, 1:500), anti-ZO-1 (#13663, Cell Signaling Technology, USA, 1:1000), and anti-GAPDH (#10494-1-AP, Proteintech, China, 1:10,000) antibodies. The membranes were incubated with the corresponding secondary antibody (#SA00001-1, #SA00001-2, Proteintech, China, 1:5000) at room temperature for 30 min. Last, membranes were incubated with chemiluminescent substrate according to the manufacture’s protocol (#E412, Vazyme, China) and visualized using Tanon-4600 automatic chemiluminescence/fluorescence image analysis system (Shanghai, China). The experiments were repeated twice.

Occludin and ZO-1 are vital tight junction proteins to maintain barrier function (25 (link)). Toll-like receptor 4 (TLR4) and its downstream myeloid differentiation factor 88 (MyD88) form an important pathway to promote the activation of microglia (26 (link)). The relative levels of Occludin and ZO-1 expression in the intestine and brain and TLR4 and MyD88 expression in the brain to the β-actin were quantified by Western blotting. Briefly, each type of tissue samples were homogenized in lysis buffer (Servicebio) and centrifuged. After determining protein concentrations using the bicinchoninic acid method, the lysates (30 μg/lane) were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis on 10% gels and transferred onto polyvinylidene fluoride membranes. The membranes were blocked with 5% non-fat dry milk in phosphate-buffered saline (PBS) containing Tween 20 and probed with anti-Occludin, anti-ZO-1, anti-TLR4, and anti-MyD88 (Cell Signal Technology) at 4°C overnight. After being washed, the bound antibodies were detected with appropriate horseradish peroxidase (HRP)-conjugated secondary antibody (Servicebio) and visualized with enhanced chemiluminescence.

Cell lysate preparation and immunoblot analyses were performed as previously reported [40 (link)]. Filters were probed with the indicated primary antibodies: anti-TIMP-1 and anti-CD99 (R&D Systems, Minneapolis, MN, USA); anti-integrin β1, anti-CD63 and anti-vinculin (Santa Cruz Biotechnology, Dallas, TX, USA); anti-vimentin, anti-integrin αv, anti-PDGFRβ, anti-pAKT, anti-pErk 1/2 and anti-ZO-1 (Cell Signaling Technology Inc., Danvers, MA, USA); anti-ITPRIPL1 (OriGene Technologies, Rockville, MD, USA); anti-NF-kB-p65 (Elabscience, Houston, TX, USA); anti-actin (Sigma-Aldrich); and anti-CD44 (Abcam, Cambridge, UK). Densitometric analysis was performed on at least two different exposures to assure the linearity of each acquisition using ImageJ software (v1.46r).

Cells (CCD986Sk, HaCaT, or B16F10) were treated with various concentrations of L. cuneata G. Don extract. Cells were lysed on ice in lysis buffer for 30 min. Total proteins were separated by electrophoresis on 8%–10% SDS polyacrylamide gel and transferred to a PVDF membrane (Merck Millipore, Burlington, MA, USA). Target proteins were detected using the following primary antibodies: anti‐ZO‐1 (1:1000), anti‐Occludin1 (1:1000), anti‐Claudin‐1 (1:1000), anti‐TRP1 (1:1000), anti‐TRP2 (1:1000), anti‐MITF (1:1000), anti‐pErk (1:1000), anti‐Erk (1:1000), anti‐pAkt (1:1000), anti‐Akt (1:1000), and anti‐β‐actin (1:5000), All antibodies were from Cell Signaling Technology. Then, membranes were incubated using and HRP‐conjugated secondary antibody (Jackson Laboratory, Bar Harbor, ME, USA). Chemiluminescence was detected using ECL (Gendepot, Barker, TX, USA).

The haematoxylin (#MHS16) and eosin solution (#HT110116), Masson trichrome (#HT15) and Oil Red O (#3125‐12) staining kit were purchased from Sigma chemicals (Sigma). Anti‐FABP2 (#ab126744), anti‐moma‐2 (#ab33451) and anti‐α‐sma (#ab7817) antibodies were purchased from Abcam. Anti‐ZO‐1 (#13663), anti‐occludin (#91131) and anti‐Tubulin (#2146) antibodies were purchased from Cell Signaling. ELISA kits for measuring intestinal TNF‐α (#88‐7324‐22), IL‐1β (#88‐7013‐22) and MCP‐1 (#88‐7391‐22) levels were purchased from Invitrogen (Thermo Fisher). Biochemical kit for detecting endotoxin level and DX‐4000‐FITC reagent (#46944) were purchased from Sigma chemicals (Sigma, St. Louis). The lentivirus encoding villin‐drived Fabp2 siRNA (#SASI_Mm01_00024824) was purchased from Sigma chemicals (Sigma).

To obtain total protein lysates, fresh tissue was ground to powder by adding lipid nitrogen. Grinding tissue or cell precipitates were lysed using cell lysates containing mixed proteinase inhibitors. The lysate was incubated on ice for 30 min followed by centrifugation at 4 °C 15000 g for 30 min. The protein concentration of each sample was assayed using the bicinchoninic acid (BCA) assay. The cytoplasmic and nuclear extracts were separated by extraction regents (Invitrogen, USA). Samples were loaded on 7.5% or 10% SDS-PAGE. After electrophoresis, the proteins were transferred from gels to PVDF membranes. The membranes were blocked in 5% low-fat dried milk in TBST for an hour at room temperature and then incubated with the primary antibodies overnight at 4 °C. The primary antibodies included anti-ACLY (Proteintech, 15,421), anti-CTNNB1 (Cell Signaling Technology, 8480), anti-E-cadherin (Cell Signaling Technology, 3195), anti-N-cadherin (Cell Signaling Technology, 13,116), anti-Vimentin (Cell Signaling Technology, 5741), anti-ZO-1 (Cell Signaling Technology, 8193), anti-Snail (Cell Signaling Technology, 3879), anti-β-actin (Cell Signaling Technology, 12,262), anti-Flag M2 (Sigma, A2220), anti-Lamin B1 (Proteintech, 66,095). The immunoreactive bands were visualized by the ECL Plus system (Tanon, China).