ChIP assays were performed as previously described (9) with minor modifications. Briefly, LNCaP and HEK93T cells grown in 10-cm dishes (80–90% confluence) were crosslinked by adding 10% formaldehyde to culture media for 6–7 min at RT, followed by addition of glycine to 125 mM. Chromatin was sonicated to yield 100–300 bp fragments in SDS lysis buffer (0.1% SDS, 5 mM EDTA, 50 mM Tris-HCl, 150 mM NaCl, 2% NP-40, 0.5% deoxycholate, pH 8.1) containing 1 mM phenylmethanesulfonyl fluoride and protease inhibitor mixture. (Roche Applied Science) Following pre-clearing with protein A/G magnetic beads (Millipore), chromatin was incubated overnight at 4°C with 5 µg of the following Ab as indicated: HA, RUNX2, or normal mouse IgG. Immunocomplexes were pulled down with protein A/G magnetic beads. Crosslinks for both ChIP and input DNA were reversed at 65°C for 5 h and proteins were digested with proteinase K, and DNA was recovered by phenol/chloroform extraction and ethanol precipitation with 20 µg of glycogen as carrier as described [27] . Precipitated fragments were quantified by qPCR, and percentage input values were corrected for negative control regions where indicated. Primers for PCR amplification of PIP as previous described [28] (link).
Protein a g magnetic beads
Manufactured by Merck Group
Sourced in United States, Germany, China
Protein A/G magnetic beads are a type of laboratory equipment used for the purification and isolation of antibodies. The beads are coated with a combination of Protein A and Protein G, which have a high affinity for the Fc region of antibodies. These magnetic beads can be used to efficiently capture and separate antibodies from complex biological samples, such as cell culture media or serum, through the use of a magnetic field.
Automatically generated - may contain errors
Lab products found in correlation
Proteinase k, by Thermo Fisher Scientific (6 mentions)
Protease inhibitor cocktail, by Thermo Fisher Scientific (4 mentions)
Bca protein assay kit, by Thermo Fisher Scientific (4 mentions)
Ez magna rip kit, by Merck Group (3 mentions)
Rnase inhibitor, by Thermo Fisher Scientific (3 mentions)
Protease inhibitor cocktail, by Roche (3 mentions)
Ripa lysis buffer, by Beyotime (3 mentions)
Magna rip rna binding protein immunoprecipitation kit, by Merck Group (3 mentions)
Normal rabbit igg, by Merck Group (3 mentions)
Nextseq 500, by Illumina (2 mentions)
N6 methyladenosine 5 monophosphate sodium salt, by Merck Group (2 mentions)
Dynabeads oligo dt 25 magnetic beads, by Thermo Fisher Scientific (2 mentions)
Protein a g beads, by Merck Group (2 mentions)
Superscript 3, by Thermo Fisher Scientific (2 mentions)
Anti m6a antibody, by Synaptic Systems (2 mentions)
Protease inhibitor cocktail, by Merck Group (2 mentions)
Protein a g magnetic bead, by Thermo Fisher Scientific (2 mentions)
M6amp, by Merck Group (2 mentions)
Rnase free dnase 1, by Roche (2 mentions)
Anti m6a, by Synaptic Systems (2 mentions)
117 protocols using protein a g magnetic beads
1
ChIP Assay Protocol for Transcription Factors
2
Co-immunoprecipitation for Protein Interactions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Co-IP assays were performed to identify the proteins. Briefly, 1 × 106 cells were collected and lysed for IP-MS in 300 μL buffer containing 1% NP40, 150 nM NaCl, 50 mM Tris-Cl (pH 7.2), 1 mM EDTA nuclear extracts (NE) and complete protease inhibitor cocktail (Roche). For Co-IP using antibodies, before being added to the cell lysates, the antibodies were incubated with Protein A/G Magnetic Beads (Millipore) for 3 h at 4 °C. Then, the crosslinked Protein A/G Magnetic Beads (Millipore) were added to the cell lysates directly and incubated overnight at 4 °C. The magnetic beads were washed with IP wash buffer and collected. The protein complexes were eluted from the beads by 50 mM glycine (pH 2.8) and analysed by MS.
3
SORBS2-Interacting RNA Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell lysates were incubated with SORBS2 (SAB4200183, MilliporeSigma) overnight at 4 °C and then immunoprecipitated with protein Pierce™ Protein A/G Magnetic Beads. RNA was extracted from the immunoprecipitated SORBS2-RNA complex using Trizol. After proteinase K digestion (Roche) and fragmentation, RNA libraries were constructed by using VAHTS™ Stranded mRNA-seq Library Prep Kit for Illumina (Vazyme) according to the manufacturer’s instructions. After proteinase K digestion (Roche), RNA libraries were constructed by using the TruSeq Stranded Total RNA Library Prep Kit (Illumina, San Diego, CA, USA) according to the manufacturer’s instructions. The library quality was assessed by Agilent 2100 Bioanalyzer. cDNA libraries were sequenced by Illumina Hiseq 4000 system according to the manufacturer’s instructions.
4
RIP Assay for SIX4 Protein Interactions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A RIP RNA-Binding Protein Immunoprecipitation Kit (MilliporeSigma) was used to conduct RIP assays. Cells were lysed in Invitrogen RIP buffer (Thermo Fisher Scientific, Inc.) after being collected by centrifugation at 200 × g for 5 min at 4°C. Then, 100 µl cell lysate was pre-cleared with 50 ul protein A/G magnetic beads (MilliporeSigma) which were conjugated to 5 µg anti-SIX4 antibody (1:500 dilution; cat. no LS-C101744; LifeSpan BioSciences, Inc.) or 5 µg anti-IgG antibody (1:50 dilution; cat. no ab172730; Abcam). A protein-RNA complex was captured and digested with 0.5 mg/ml proteinase K containing 0.1% SDS to extract RNA. The magnetic beads were repeatedly washed with RIP washing buffer to remove non-specific adsorption. Finally, the expression levels of SIX4 were determined using an RT-qPCR assay as described above.
5
ChIP Assay for NF-κB-p65 Binding Sites
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Magna ChIP™ A/G Chromatin Immunoprecipitation Kit (17–10085, Millipore Sigma, Burlington, Massachusetts, USA) was used for the Chromatin Immunoprecipitation (ChIP) assay [25 ]. AGS cells cultured in 10-cm plates were fixed with 37% formaldehyde, followed by adding cell and nuclear lysis buffer. Chromatin fragments were sonicated on ice for 6 cycles (30s On and 30s Off at 40% amplitude). The shear cross-linked DNA was sonicated into 100–1000 bp for the best efficiency of pull-down. The immunoprecipitation antibody NF-kB-p65 (Ser536) (3033S, Cell Signaling Technology) and control antibody normal mouse IgG (12–371, Millipore Sigma), as well as protein A/G magnetic beads (CS204457, Millipore Sigma), were added into lysates and incubated at 4 °C overnight. Elution of the protein/DNA complexes was obtained after DNA purification using wash buffers and standard PCR. We designed three pairs of primers for potential NF-κB-p65 binding sites: PRDX2-1-CHIP-F: 5′- GATGGAGTCTTGCTGTGTGG -3′, PRDX2-1-CHIP-R: 5′- CATAGGGGAAAGGGGCAGAT -3’ (Primer 1: −1083 —— −921 bp); PRDX2-2-CHIP-F: 5′- CACACCTCACCGACCTCTTT -3′, PRDX2-2-CHIP-R: 5′- GAAGCTGTCACTCGGGGATA -3’ (Primer 1: −832 —— −594 bp); PRDX2-3-CHIP-F: 5′- TGCCCACACCCTCTCTTC -3′, PRDX2-3-CHIP-R: 5′- TTGCCCTACTTCTCCTGCTG -3’ (Primer 1: −587 —— −403 bp).
6
SAOS-2 Cell Immunoprecipitation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SAOS-2 cells were lysed in RIPA buffer (Protech Technology Enterprise Co., Ltd.) including protease inhibitors at 4˚C to obtain the protein. Subsequently, samples (250 µl) were incubated overnight at 4˚C with IgG (1:50; cat. no. ab172730; Abcam), anti-APOC1 (1:40; ab198288; Abcam) or anti-MTCH2 antibodies (1:50; 16888-1-AP; Proteintech). A total of 30 µl protein A/G magnetic beads (MilliporeSigma) was added and incubated overnight at 4˚C. The beads were washed with PBS and immunoprecipitants were assessed via western blotting.
7
ChIP-seq Analysis of AR and WT1 in Sertoli Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To characterize genome-wide binding patterns of AR and WT1 in Sertoli cells, ChIP and input DNA libraries were performed as previously described [33 (link)]. Briefly, cells were cross-linked with 1% formaldehyde for 10 min at room temperature and formaldehyde was then inactivated by the addition of 125 mM glycine for 5 min. Sonicated DNA fragments with 100–300 bp were pre-cleared and then immunoprecipitated with Protein A + G Magnetic beads coupled with anti-Androgen Receptor antibody (Millipore, 06–680) or anti-Wilms’ tumor 1 antibody (Abcam, ab89901). After reverse crosslinking, immunoprecipitated DNAs and input DNAs were end-repaired and ligated adapters to the DNA fragments using NEBNext Ultra End-Repair/dA-Tailing Module (E7442, NEB) and NEBNext Ultra Ligation Module (E7445, NEB). High-throughput sequencing of the ChIP fragments was performed using Illumina NextSeq 500 following the manufacturer’s protocols. The raw sequencing data were processed with trimmomatic (version 0.36) to filter low-quality reads [34 (link)]. The resulting data were mapped using bowtie2 (version 2.2.9) to the UCSC mm10 genome reference [35 ]. Peak detection was performed using the MACS peak finding algorithm (Model-based Analysis of ChIP-Seq; version 1.4.2) with parameters --nomodel --shiftsize 25 and the p-value cutoff set to 0.05 [36 (link)].
8
Isolation and Quantification of m6A-modified RNA
9
Immunoprecipitation of Protein Complexes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Indicated plasmids were transfected using Lipofectamine 2000 (Life Technologies). Cells were collected 48 h post-transfection and lysed in Triton lysis buffer (50 mM Tris pH 7.5, 150 mM NaCl, 2 mM MgCl2, 0.5 mM EDTA, 0.5% Triton X-100, and protease inhibitors) for 30 min on ice. Cell lysates were cleared by centrifugation and incubated with the primary antibodies overnight at 4 °C, followed by incubation with Protein A/G magnetic beads (Millipore) for 2 h at 4 °C. Beads were washed 3 times with Triton lysis buffer and eluted with Laemmli buffer. Immunoprecipitates were resolved by SDS-PAGE and analyzed by western blot with the indicated antibodies, listed in Supplementary Table 2 . Uncropped scans are available in Supplementary Fig. 11 and Supplementary Fig. 12 .
10
Co-Immunoprecipitation of Proteins in Tobacco
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For co‐immunoprecipitation (Co‐IP) assays, total proteins from homogenised tobacco were extracted using extraction buffer (50 mM Tris‐HCl, pH 7.5, 150 mM NaCl, 2 mM EDTA, 10% glycerol, 0.2% 2‐mercaptoethanol, 1% Triton X‐100, 1 mM phenylmethylsulfonyl fluoride (PMSF), and 1× protease inhibitor cocktail) and incubated for 30 min at 4°C with gentle agitation. After centrifugation at 12 000 g for 15 min at 4°C, supernatant was incubated with protein A + G magnetic beads (Millipore 16‐663) for 1 h for preclearing at 4°C. The precleared protein solution was incubated with 50 µl anti‐GFP mAb‐magnetic beads (MBL D153‐11) overnight at 4°C. The supernatant was removed, and the magnetic beads were washed three times with extraction buffer. The proteins were eluted with 2× SDS sample loading buffer and analysed by immunoblotting using anti‐myc antibody (MA1‐980; Thermo Fisher, Waltham, MA, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!