Total RNA was extracted from cells using RNeasy kit (Qiagen, Germany). 2 × 106 cells were centrifuged and washed twice with PBS. RNA was isolated from these cells as per the manufacturer's instructions. 1.5 μg of total RNA was converted to cDNA using MMLV-RT (Thermo scientific, USA) and Oligo-dT primers (NEB, USA). miRNA conversion to cDNA was carried out using stem-loop reverse transcriptase (RT) primers without dithiothreitol (DTT) and the RNA denaturation step to maintain integrity of the stem-loop primer.
Oligo dt primer
Manufactured by New England Biolabs
Sourced in United States
Oligo-dT primers are a type of oligonucleotide used in molecular biology techniques, such as reverse transcription. They are composed of a sequence of deoxythymidine nucleotides, typically between 12 and 18 in length, designed to hybridize to the poly(A) tail of mRNA molecules. Oligo-dT primers serve as initiators for the synthesis of complementary DNA (cDNA) from mRNA templates, a crucial step in the process of reverse transcription.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy kit, by Qiagen (4 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (4 mentions)
Moloney murine leukemia virus reverse transcriptase, by Promega (3 mentions)
Protoscript 2 reverse transcriptase, by New England Biolabs (3 mentions)
Luna universal qpcr master mix, by New England Biolabs (3 mentions)
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
M mlv rt, by Thermo Fisher Scientific (2 mentions)
Abi prism 7500 fast rt pcr system, by Thermo Fisher Scientific (2 mentions)
Sybr green pcr master mix, by Takara Bio (2 mentions)
Rneasy mini kit 250, by Qiagen (2 mentions)
Gotaq 2 step rt qpcr system, by Promega (2 mentions)
Cfx96 pcr machine, by Bio-Rad (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Rnase inhibitor, by Thermo Fisher Scientific (2 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Superase in, by Thermo Fisher Scientific (2 mentions)
Nucleozol reagent, by Macherey-Nagel (1 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (1 mentions)
Random primer, by New England Biolabs (1 mentions)
Sybr green jumpstart taq readymix, by Merck Group (1 mentions)
32 protocols using oligo dt primer
1
RNA Extraction and cDNA Synthesis
2
Quantitative RNA Analysis of HCV and Neurochemical Pathways
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA extraction from cells was performed using nucleoZOL reagent (Macherey-Nagel, Duren, Germany) according to the manufacturer’s instructions. cDNA synthesis was carried out with Moloney murine leukemia virus reverse transcriptase (Promega Corporation, Madison, WI, USA) based on the manufacturer’s protocol. For HCV positive-strand RNA quantitation, reverse transcription (RT) reactions included the HCV-specific primer JFH1-354R, as well as the primer YWHAZ-R (Table 1 ), specific for the housekeeping gene 14-3-3-zeta polypeptide (YWHAZ) used as internal control (3.5 pmol/μL of each primer). For the quantification of cellular transcripts, oligo(dT) primers (New England Biolabs, Ipswich, MA, USA) were included. Real-time quantitative PCR was performed using Luna® Universal qPCR Master Mix (New England Biolabs, Inc. Ipswich, MA, USA), as well as primer pairs specific for the HCV IRES (JFH1-276F and JFH1-354R), the exons 10-12 of full-length DDC mRNAs, TH, DBH, MAO-A, MAO-B, VMAT2, OCT1, NRF2, HO-1 and VEGFA mRNAs. The YWHAZ housekeeping gene was used as a normalization control in all qPCR reactions, as its expression was not affected upon viral infection.
3
Quantitative Analysis of Inflammatory Gene Expression in Macrophages
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from BMDMs infected with wt or ∆gapA for 8 h using RNeasy kit from Qiagen (Hilden, Germany). One microgram of total RNA was reverse-transcribed using oligo (dT) primers (New England Biolabs, Ipswich, MA, USA). Quantitative real-time PCR analysis was performed and analyzed using the ABI Prism 7500 Fast RT-PCR System (Applied Biosystems, Waltham, MA, USA). The results were normalized to the housekeeping gene 18S rRNA (Rn18S1) and expressed as fold change relative to RNA samples from mock-treated cells using the comparative Ct method (ΔΔCt). The following TaqMan Gene Expression Assays (Applied Biosystems) were used: Il1b (Mm00434228_m1), Tnf (Mm00443258_m1), Il10 (Mm01288386_m1), Il12b (Mm01288989_m1), Ifnb1 (Mm00439552_s1), Il6 (Mm00446190_m1), Nos2 (Mm00440502_m1), Arg1 (Mm00475988_m1), and housekeeping gene Rn18s (Mm03928990_g1).
4
Hypoxia Transcriptional Profiling of Myeloma Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RPMI-8226, LP-1, U266, OPM-2, KMS-12-BM and HS-5 cells were cultured in 21% O2 and 1% O2 and harvested after 0, 1, 3, 5 and 7 days or 0, 1 and 7 days. RNA was isolated using the NucleoSpin RNA purification kit (Macherey-Nagel, Dueren, Germany, #740962.20) according to the manufacturer’s instructions. An amount of 3 μg of RNA was reverse-transcribed with 2 μM oligo(dT) primers (NEB, # S1327S), 2 μM random primers (New England Biolabs, Frankfurt, Germany,, # S1330S), dNTPs (New England Biolabs, #N0446S), RNAse inhibitor (Thermo Fisher Scientific, #10777019) and 200 units Moloney murine leukemia virus reverse transcriptase (ProtoScript II reverse transcriptase, New England Biolabs, #M0368) in a total volume of 20 μL. Real-time PCRs (Opticon 2 reader, MJ research, now BioRad, Dreieich, Germany) were performed in triplicates with 2.5 μL of 5-fold diluted cDNA in a 25 μL reaction using SYBR® Green JumpStart™ Taq ReadyMix™ (Sigma-Aldrich, #S4438). The annealing temperature was 60 °C for all PCR reactions. Primers are listed in Table 1 . The reference gene TATA-box-binding protein (TBP) was used for normalization.
5
Quantifying AR Expression in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To determine
the expression
level of AR, the cells were grown for 24 h in a 6 cm culture plate
(1 × 106 cells per plate) followed by different treatment
for 24 h in DMEM-CSFBS. The total RNA was extracted using the RNA-XPress
(Himedia Mumbai, India) following the manufacturer’s instructions.
The quantity and purity were determined using the Nanodrop spectrophotometer
(Thermo Fisher Scientific, USA). Equal quantity of total RNA from
different treatment groups (1000 ng) was reverse transcribed using
the MMLV reverse transcriptase and oligo dT primers (New England Biolab,
USA). The difference in transcript level was quantified using real
time PCR (quant studio 3, applied biosystem USA) with the SYBR green
master mix (Applied Biosystem, USA). β-Actin was used as a housekeeping
gene for the normalization, and the 2−ΔΔCt method
was used to determine the difference in transcript level.34 (link) Details of primers are provided inTable 1 .
the expression
level of AR, the cells were grown for 24 h in a 6 cm culture plate
(1 × 106 cells per plate) followed by different treatment
for 24 h in DMEM-CSFBS. The total RNA was extracted using the RNA-XPress
(Himedia Mumbai, India) following the manufacturer’s instructions.
The quantity and purity were determined using the Nanodrop spectrophotometer
(Thermo Fisher Scientific, USA). Equal quantity of total RNA from
different treatment groups (1000 ng) was reverse transcribed using
the MMLV reverse transcriptase and oligo dT primers (New England Biolab,
USA). The difference in transcript level was quantified using real
time PCR (quant studio 3, applied biosystem USA) with the SYBR green
master mix (Applied Biosystem, USA). β-Actin was used as a housekeeping
gene for the normalization, and the 2−ΔΔCt method
was used to determine the difference in transcript level.34 (link) Details of primers are provided in
6
Quantitative PCR analysis of gene expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from cells using the QIAGEN RNeasy kit per manufacturer’s instructions. Complementary DNA (cDNA) was synthesized from 1 μg of each RNA sample using the One Taq RT-PCR Kit and oligo-dT primers (New England BioLabs). cDNA was diluted 1:5 and 1 μL was used for qPCR per reaction. qPCR was performed by using 400 nM of each forward and reverse primer and SYBR Green PCR Master Mix (Life Technologies). qPCR was performed on Viia 7 Real-Time PCR System (Thermo Scientific). Primer sequences are as follows: PDLIM7 (Fw- CAGAGCCGCACCTCCATTG, Rev- TGGTGACACACGGGAGTCT), CREBBP (Fw- CCTGCCACGTCACAGACTG, Rev- GGCCAGAGTTACTATTGAGGAGG), p300 (Fw- GCTTCAGACAAGTCTTGGCAT, Rev- ACTACCAGATCGCAGCAATTC, PKCD (Fw- GTGCAGAAGAAGCCGACCAT, CCCGCATTAGCACAATCTGGA), NEDD4-1 (Fw- TCCAATGATCTAGGGCCTTTACC, Rev- TCCAACCGAGGATCTTCCCAT), β-actin (Fw- CATGTACGTTGCTATCCAGGC, Rev- CTCCTTAATGTACGCACGAT).
7
Quantitative real-time RT-PCR analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with TRIzol® reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. Superscript III reverse transcriptase (Invitrogen) and oligo (dT) primers (New England Biolabs) were used to reverse transcribe total RNA (3 μg). The product (1 μL) was amplified by PCR using the following primer pairs: hTimeless, forward 5′‐CATCTAGCCCAGAAGAAGTG‐3′ and reverse 5′‐GAGACAGTCTTGGATCCGTA‐3′; hChd6, forward 5′‐ATGTACCTCTGCCTGACA TC‐3′ and reverse 5′‐GTCTGAGGTCCCATCTGTAA‐3′; hCpne7, forward 5′‐GGAGAC AAGGCCTCTAAAGT‐3′ and reverse 5′‐AGTACACCCTGTGGAACTTG‐3′; hGapdh, forward 5′‐ATCATCCCTGCCTCTACTG‐3′ and reverse 5′‐TTG AAGTCAGAGGAGACCAC‐3′. ABI PRISM 7500 sequence detection system (Applied Biosystems, Carlsbad, CA, USA) and SYBR Green PCR Master Mix (Takara Bio, Shiga, Japan) were used according to the manufacturer's instructions. Following condition was set: 40 cycles of 95°C for 1 min, 94°C for 15 s, and 60°C for 34 s. Housekeeping gene Gapdh was used to normalize PCR products. All reactions were performed in triplicate. Relative changes in gene expression were calculated using the comparative threshold cycle (Ct) method (n = 3, each group).
8
Quantitative RT-PCR Protocol for Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA was synthesized using ProtoScript First Strand cDNA Synthesis Kit with oligo-dT primers (New England BioLabs Inc.; E6300L). qRT-PCR was then performed using QuantStudio 12K Flex Real Time PCR system with a Power SYBR green PCR Master Mix Kit (Applied Biosystems).
Reaction was performed as follows:
Lists of all primers used in these experiments are presented in Supplementary Tables1 and 2 .
Reaction was performed as follows:
50 °C 2 min, 1 cycle.
95 °C 10 min, 1 cycle.
95 °C 15 s -> 60 °C 1 min, 40 cycles.
95 °C 15 s, 1 cycle.
60 °C 1 min, 1 cycle.
95 °C 15 s, 1 cycle.
Lists of all primers used in these experiments are presented in Supplementary Tables
9
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with RNeasy Mini Kit (250) from Qiagen according to the manufacturer’s instructions. The RNA concentration was measured with Nanodrop 8000 spectrophotometer (Thermo Scientific) and 1 μg of RNA was used to produce cDNA with the ProtoScript M-MuLV Taq RT-PCR kit using the oligo dT primers (New England BioLabs). Semi-quantitative real-time analysis (qPCR) was done with a 7500 qPCR System (Applied Biosystems, USA) using a GoTaq 2-step RT-qPCR System (Promega) to amplify the gene of interest following the instructions provided. Primer sequences are listed in Additional file 1 : Table S1.
10
Cytokine Expression Profiling in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TNF-α and IL-6 were assayed using mouse R&D Systems ELISA kit. RNA was isolated from cells using RNeasy kit from Qiagen. 1 μg of total RNA was reverse transcribed using oligo(dT) primers (New England Biolabs). Quantitative Real-time PCR analysis was performed and analyzed using ABI Prism 7500 Fast RT-PCR System (Applied Biosystems). The results were normalized to the housekeeping genes and expressed as fold change relative to RNA samples from control or mock-treated cells/mice using the comparative CT method (ΔΔCT). All Taqman gene expression data are presented as the expression relative to 18 S rRNA reference gene (Rn18s). The following TaqMan Gene Expression probes were used (Applied Biosystems): Tnf (Mm00443258_m1), Il6 (Mm00446190_m1) and Rn18s (Mm03928990_g1).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!