Total RNA was extracted from the wild type and Ndrg3+/− mouse indicated, tissues or isolated primary cells homogenized in TRIzol reagent (Invitrogen), followed by RNA precipitation. cDNA was synthesized with a reverse transcription kit (TaKaRa). Real-time PCR was performed using SYBR Premier EX Taq (TaKaRa). Genes were amplified with the indicated primers (Supplemental Table ). Relative levels of mRNAs were calculated using MX3500pro software and normalized to the levels of endogenous β-Actin in the same samples.
Sybr premier ex taq
Manufactured by Takara Bio
Sourced in Japan
SYBR Premier EX Taq is a high-performance DNA polymerase designed for real-time PCR applications. It is capable of rapid and accurate DNA amplification.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Reverse transcription kit, by Takara Bio (2 mentions)
Quantstudio 6 flex real time pcr system, by Thermo Fisher Scientific (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Superscript 4 vilo master mix, by Thermo Fisher Scientific (1 mentions)
Primescript rt kit, by Promega (1 mentions)
Mir x mirna first strand synthesis kit, by Takara Bio (1 mentions)
Superscript 3 first strand system kit, by Thermo Fisher Scientific (1 mentions)
6 protocols using sybr premier ex taq
1
Ndrg3 Gene Expression Analysis
2
Quantitative Analysis of Mouse Spermatocyte RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the control and Uhrf1-cKO mouse spermatocytes (leptotene/zygotene stage and pachytene stage) were isolated. The primary cells were homogenized in TRIzol reagent (Invitrogen), followed by RNA precipitation. cDNA was synthesized from 1 μg RNA with a reverse transcription kit (TaKaRa). Real-time PCR was performed using SYBR Premier EX Taq (TaKaRa). Relative levels of mRNAs were normalized to the levels of endogenous β-Actin in the same samples. Genes were amplified with the specific primers (Table S1 ).
3
Quantifying ACE2 Expression via qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qRT-PCR was performed as described in (Vasudevan et al., 2020 (link)). In short, RNA was extracted using TRIzol (Life Technologies; Cat. No. 15596018) and then purified with a Qiagen RNeasy Mini Kit (Cat. No. 74106). RNA was converted to cDNA using SuperScript IV VILO Master Mix (Thermo Fisher Scientific; Cat. No. 11756500). Quantitative PCR was performed using SYBR Premier Ex Taq (Takara; Cat No. RR420L) and quantified using the QuantStudio 6 Flex Real-Time PCR system (Applied Biosystems). The primers for ACE2 were as follows: (set 1) 5’-CGAAGCCGAAGACCTGTTCTA and 5’-GGGCAAGTGTGGACTGTTCC and (set 2) 5’-CAAGAGCAAACGGTTGAACAC and 5’-CCAGAGCCTCTCATTGTAGTCT. GAPDH was assessed as a control using primers 5’-TGCACCACCAACTGCTTAGC and 5’-GGCATGGACTGTGGTCATGAG.
4
Quantitative Analysis of Gene and miRNA Expressions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of tissues and cells was extracted using TRIzol reagent (Ambion, Life Technologies Corp., Carlsbad, CA, USA) and reverse transcribed with PrimeScript RT kit (Promega). Tim-1, miR-133a and TGFBR1 were determined using SYBR Premier ExTaq (Takara Biotechnology Co., Ltd., Tokyo, Japan) and Mir-X miRNA First Strand Synthesis Kit (Takara), respectively. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or U6 served as the standardized control for Tim-1, TGFBR1, and miR-133a. Gene relative mRNA expression was analyzed using the 2−△△Ct method. Primer sequence is listed in Table 1 .
Primer sequence for qRT-PCR
| Primer | Sequence (5'->3') |
|---|---|
| miR-133a | Forward primer: ACACTCCAGCTGGGTTTGTCCCCTTCAAC |
| Reverse primer: TGGTGTCGTGGAGTCG | |
| U6 | Forward primer: CTCGCTTCGGCAGCACA |
| Reverse primer: AACGCTTCACGAATTTGCGT | |
| Tim-1 | Forward primer: TACCCTGTATCAGGACCAGGA |
| Reverse primer: GAGAGCTCTGTGCCTTCCAA | |
| TGFBR1 | Forward primer: GCAGAGCTGAGCCTTGAGAG |
| Reverse primer: TGCCCTGTTGACTGAGTTGTG | |
| GAPDH | Forward primer: CACCATCTTCCAGGAGCGAG |
| Reverse primer: AAATGAGCCCCAGCCTTCTC |
5
RNA Extraction and Quantitative PCR Protocol
6
Annotating Genes with Gene Ontology
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A gene annotation file was retrieved from ensembl genome browser 96 database.1 To annotate genes with Gene Ontology (GO), clusterProfiler v3.4.4 (R package) was used.
The raw next-generation sequencing (NGS) data were deposited to the NCBI SRA database under project number (PRJNA691984). Reverse transcription polymerase chain reaction (RT-PCR) was performed to verify the mRNA-seq results using SYBR Premier EX Taq (TaKaRa). Genes were amplified with the indicated primers (Supplementary Table 1 ). Relative levels of mRNAs were calculated using MX3500pro software and normalized to the levels of endogenous actin in the same samples.
The raw next-generation sequencing (NGS) data were deposited to the NCBI SRA database under project number (PRJNA691984). Reverse transcription polymerase chain reaction (RT-PCR) was performed to verify the mRNA-seq results using SYBR Premier EX Taq (TaKaRa). Genes were amplified with the indicated primers (
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!