We used reverse transcriptase-polymerase chain reaction (RT-PCR) to validate 10 non-canonical U2/12-like and 4 non-U2/U12 splice junctions. We used Human Universal RNA samples (SABiosciences) and different RTs: MMLV (RevertAidFirst Strand cDNA Synthesis), AMV (Promega) or Transcriptor (Roche) to do the RT-PCR. The PCR amplification was carried out using a touchdown thermocycling program (31 (link)) during 35 cycles and products were analyzed by gel electrophoresis. The presence of the different isoforms detected were corroborated using Sanger sequencing of the RT-PCR products subcloned using the pGEM-T Easy Vector System (Promega). The primers for the RT-PCR are listed in Supplementary Table S1.
Transcriptor
Manufactured by Roche
Sourced in United States, Switzerland, Italy
Transcriptor is a laboratory equipment designed for the reverse transcription of RNA into complementary DNA (cDNA). It is a critical tool for various molecular biology applications, including gene expression analysis, RNA sequencing, and cDNA library construction.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (3 mentions)
Universal probe library set, by Roche (3 mentions)
7900ht fast real time pcr system, by Thermo Fisher Scientific (3 mentions)
Taqman primer probes sets, by Thermo Fisher Scientific (2 mentions)
Abi 7500 fast real time pcr machine, by Thermo Fisher Scientific (2 mentions)
Tripure, by Roche (2 mentions)
Rneasy kit, by Qiagen (2 mentions)
Quantstudio 5 real time system, by Thermo Fisher Scientific (2 mentions)
Nanodrop 2000c, by Thermo Fisher Scientific (2 mentions)
Pgem t easy vector system, by Promega (1 mentions)
480 sybr green 1 master, by Roche (1 mentions)
Ex taq dna polymerase, by Takara Bio (1 mentions)
Sybr premix ex taq tli rnaseh plus, by Takara Bio (1 mentions)
Rneasy plant mini kit, by Qiagen (1 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (1 mentions)
Lightcycler 480 2, by Roche (1 mentions)
Ssofast evagreen, by Bio-Rad (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Rnaseout, by Thermo Fisher Scientific (1 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (1 mentions)
20 protocols using transcriptor
1
Validating Non-canonical Splice Junctions
2
cDNA Synthesis and qPCR Analysis
3
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were harvested in Trizol (Life Technologies; Carlsbad, CA) or TriPure (Roche; Nutley, NJ) and RNA was prepared according to the manufacturers’ protocols. RNA was DNase treated (Roche) and cDNA was reverse transcribed using Transcriptor (Roche) with oligo dT as the primer. cDNA was used as template in a real time PCR reaction using ABI Taqman primer-probes sets (Table 3 ) on a ABI 7500 Fast real time PCR machine (Life Technologies). cDNA was semi-quantitated using the ΔΔCT method with Hprt (mouse) or HPRT (human) as an internal control for all samples.
4
Quantitative Real-Time PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gene expression analysis was performed on infiltrated leaves, 4 d after infiltration. RNA was isolated using TRIzol® (http://www.lifetechnologies.com ) and DNAse-treated with DNA-free:Ambion (http://www.ambion.com/ ). Reverse transcription was performed using oligo(dT) according to the manufacturer’s protocol (Transcriptor: Roche Diagnostics, http://www.roche.com/ ). Quantitative real-time PCR was carried out using the LightCycler 480 System, using 480 SYBR® Green I Master (Roche Diagnostics). Reactions were performed in quadruplicate and a non-template control was included in each run. The data were analysed using the LightCycler® 480 software 1.5 normalised to tobacco actin (GQ281246) and calibrated to the control (empty vector) infiltration (primer sequences in Supplementary Table S1 ).
5
RNA Extraction and RT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with an RNeasy Plant Mini Kit (QIAGEN) according to the manufacturer’s protocol and the quality and quantity of the resultant RNA were evaluated using a NanoDrop 2000c spectrophotometer (ThermoFisher Scientific). One μg of total RNA was reverse-transcribed in a 20 μl reaction mixture using Transcriptor (Roche). After the reaction, the mixture was diluted with 180 μl of distilled water and 2 μl aliquots were used for PCR in a 10 μl PCR reaction mixture containing 1 μl of 10× Ex Taq buffer, 1 μl of 2 mM dNTPs, 0.4 μl of 10 μM each of primers, and 0.05 μl of Ex Taq DNA polymerase (Takara) for semi-quantitative RT-PCR analysis. The PCR products were separated on a 2.5% (w/v) agarose gel, stained with ethidium bromide, and visualized under UV light. The primers used in these experiments are listed in Supplementary Table 3 . For quantitative RT-PCR analysis, the cDNA samples were diluted with 220 µl of distilled water and 2 μl aliquots were amplified with the CFX96 Real-time PCR Detection System (Bio-Rad) using SYBR Premix Ex Taq (Tli RNaseH Plus) (Takara). The two-step PCR cycling program was performed according to manufacturer’s protocol. The primers used in these experiments are listed in Supplementary Table 3 . MpACT1 was used as an internal control.
6
Knockdown of MEF2 in Drosophila Neurons
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
elav-GAL4 females were crossed to UAS-MEF2 RNAi males to generate progeny in which MEF2 was knocked down in all neurons; and progeny of elav-GAL4 crossed to w(CS10) served as controls. Total RNA was extracted from Drosophila heads from three independent crosses for each genotype with the RNeasy Mini kit (Qiagen) according to the manufacturer’s instructions. cDNA was synthesized from 1 μg of total RNA with Transcriptor (Roche) as per the manufacturer’s instructions. RT-qPCR was conducted using SsoFast-EvaGreen (BioRad) reaction master on a Lightcycler II 480 instrument (Roche), following manufacturer’s instructions. The following primers were used: Mef2for 5′-GCCACATCACACCCACTCC-3′, Mef2rev 5′-GCTGGCCATAGCAGTCGTAG-3′, EF1a48Dfor 5′-ACTTT GTTCGAATCCGTCGC-3′, EF1a48Drev 5′-TACGCTTGTCGA TACCACCG-3′. A fivefold dilution of cDNA from control flies was used as template to prepare a standard curve to confirm efficiency of the PCR reactions. Relative quantification was conducted using 2–ΔΔCt method, normalizing to the housekeeping gene Ef1α48D (Livak and and Schmittgen, 2001 (link)).
7
RNA Extraction and qRT-PCR Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA extractions were performed using miRNeasy kit (Qiagen) as recommended by the manufacturer. RNA integrity of each sample was assessed with an Agilent 2100 Bioanalyzer. Reverse transcription was performed at 55°C on a fixed volume (11 μl) of RNA sample with Transcriptor (Roche Diagnostics), random hexamers, dNTPs and 10 units of RNaseOUT (Invitrogen) in a total volume of 20 μl. All cDNAs were diluted in RNAse DNAse-free water (IDT). Quantitative PCR reactions (Supplementary File 1, Figure S1) were performed on 10 ng of cDNA as described elsewhere (45 (link)). Relative expression levels were calculated using the qBASE framework (46 (link)) using PSMC4 and SDHA as reference genes. Primer design and validation were evaluated as described (45 (link)). In every run, a no template control was performed for each primer pair. These controls were consistently negative. To measure the abundance of U31 (Supplementary File 1, Figure S6), real-time PCR quantification was performed as described (45 (link)). Fifty nanogram of total RNA was reverse transcribed using Transcriptor Reverse Transcriptase (Roche) and the PCRs were performed in a realplex (Eppendorf) using primers complementary to the sequence of U31 RNA (U31_forward: TGAGTTGAATACCGCCCCAG and U31_reverse: GCTCAGAAAA TACCTTTCAGTCAC).
8
Comparative Reverse Transcription Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Aliquots of 600, 300, 150 or 75 ng of each RNA, alongside a sample containing only water (RT0; to control for contamination of reagents), were reverse-transcribed using one of four systems: Transcriptor (Roche), SuperScript IV (ThermoFisher), iScript (BioRad) or SuperScript II (ThermoFisher; using Illumina TruSeqStranded Total RNA reagents and protocols), essentially following manufacturers’ recommendations while keeping optional choices (e.g. primers, or pre-RT heat-denaturation of RNA) as consistent as possible. For each system, a pool of 200 ng of each of the RNAs was also treated alongside individual samples with the omission of the enzyme (RT-; to estimate possible contribution of traces of genomic DNA to quantitative PCR amplification). To minimise error (e.g. pipetting of small volumes), all non-template reagents were combined into master mixes.
9
Total RNA Purification and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was purified and RT-qPCR performed as in (28 (link)). cDNA was prepared from 5μg of DNase-treated RNA in a 10-μl reaction mixture containing 5x First strand synthesis buffer, 0.1-M dithiothreitol (DTT), 10-U RNase inhibitor (Roche), 10 mM of each deoxyribonucleotide, 250 nM mix of gene-specific primers and 7.5-U Transcriptor (Roche). Residual RNA was hydrolyzed by the addition of 15 μl of 0.1-mg/ml RNaseA and incubation at 37°C for 1 h. cDNA was then diluted 1/20. qPCRs were performed in triplicate with Brilliant III SYBR Master mix (Agilent) in a Roche LC480. Reaction volumes were 10 μl, (4μl 2x SYBR green qPCR mix and 300 nM each primer, 4μl of cDNA template). Cycling parameters were: 3 min at 94°C, then 50 cycles of 5 s at 94°C, 10 s at 60°C. Oligonucleotides are listed in Supplementary Table S3. Figure 3A illustrates positions of amplicons.
10
Quantification of CB1 and CB2 Receptors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Complementary DNA was obtained from cells using Transcriptor (Roche Applied Science, Indianapolis, IN, USA). Real-time quantitative PCR assays were performed using the FastStart Universal Probe Master mix with Rox (Roche Applied Science), and probes were obtained from the Universal ProbeLibrary Set (Roche Applied Science); CB1 sense primer 5′-CATTAAGACGGTGTTTGCATTCT-3′ CB1 antisense primer 5′-CGTGTCGCAGGTCCTTACTC-3′ CB2 sense primer 5′-GACACGGACCCCTTTTTGCT-3′ CB2 antisense primer 5′-CCTCGTGGCCCTACCTATCC-3′ or from Ambion (Life Technologies, Carlsbad, CA, USA). Amplifications were run in a 7900 HT-Fast Real-time PCR System (Applied Biosystems, Foster City, CA, USA). Each value was adjusted by using 18S RNA levels as a reference.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!