Encapsulated miRNAs were extracted using miRNase (Quiagen) according to the manufacturer’s instruction. From making template to quantification of miRNAs were performed as previously described (15 (link)). Briefly, the templates were made from 10 ng of total RNA using microRNA reverse transcription kit (Life Technologies) with specific primers, which are provided with TaqMan microRNA probes (Life technologies). Real-time PCR quantification for miRNA expression was performed using a TaqMan microRNA expression assay from Life Technologies. Cq value was converted to relative number using power formulation.
Taqman microrna probe
Manufactured by Thermo Fisher Scientific
Sourced in United States
TaqMan microRNA Probes are designed for the detection and quantification of microRNA expression levels. They provide a sensitive and specific method for measuring mature microRNA sequences. The probes utilize the 5' nuclease activity of Taq DNA polymerase to cleave a dual-labeled probe, generating a fluorescent signal proportional to the amount of target microRNA present in a sample.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (12 mentions)
Mirnase, by Qiagen (2 mentions)
Taqman microrna expression assay, by Thermo Fisher Scientific (2 mentions)
Microrna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Taqman microrna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Taqman pcr kit, by Thermo Fisher Scientific (2 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions)
Mirneasy mini kit, by Thermo Fisher Scientific (1 mentions)
Amv reverse transcriptase, by Takara Bio (1 mentions)
7500 sequence detection system, by Thermo Fisher Scientific (1 mentions)
Stepone, by Thermo Fisher Scientific (1 mentions)
Total exosome rna and protein isolation kit, by Thermo Fisher Scientific (1 mentions)
Mirneasy ffpe kit, by Qiagen (1 mentions)
Taqman small rna assay kit, by Thermo Fisher Scientific (1 mentions)
Sybr green assay, by Takara Bio (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Lightcycler 480 system, by Roche (1 mentions)
Mirna specific primer, by Thermo Fisher Scientific (1 mentions)
Mirneasy mini kit, by Qiagen (1 mentions)
21 protocols using taqman microrna probe
1
Quantitative miRNA Expression Analysis
2
Quantifying Cellular microRNA Levels
3
Validation of EV-associated miRNA Profiles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We performed RT-qPCR analysis of selected EV-associated miRNAs related to LVI in the validation cohort to validate the small RNA sequencing data. EV-associated miRNAs were isolated using the miRNeasy Mini Kit and cDNAs were generated using the TaqMan MicroRNA Reverse Transcription Kit (Thermo Fisher Scientific, Waltham, Massachusetts). Gene-specific TaqMan MicroRNA Probes (Thermo Fisher Scientific) were used for quantitative analyses of the miRNA transcript levels of miR-99b-3p, miR-26a-5p, miR-93-5p, miR-30d-5p, miR-365b-3p, miR-29c-3p, miR-486-3p, miR-486-5p, and miR-548ae-5p. To normalize miRNA expression, let7f was selected as an internal control in our experiment because the gene as an endogenous control miRNA has been reported to be stable during senescence and aging26 (link).
4
Quantification of miRNA Levels in Cultured Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Twenty-four hours after treatment as described above, total RNA was extracted from cultured cells by TRIzol Reagent (Thermo Fisher Scientific) according to the guide, and RT-PCR reaction was performed immediately. Levels of mature miR-124-3p, miR-137, miR-181b-5p, and miR-454-3p were quantified using TaqMan microRNA probes (Thermo Fisher Scientific) according to the instructions. Basically, 2 µg of total RNA was transformed into cDNA by using AMV reverse transcriptase (TaKaRa, Shiga, Japan) and a stem-loop primer (Thermo Fisher Scientific). The mixture was incubated at 16°C for 15 minutes, 42°C for 60 minutes, and 85°C for 5 minutes to form a library of miRNA cDNAs. qRT-PCR was performed using a TaqMan PCR kit on a 7500 Sequence Detection System (Thermo Fisher Scientific). All the sequences were repeated three times. In addition, U6 small nuclear RNA was used as a control. The relative amount of miRNA to internal control U6 transcript was calculated using the equation, ΔCt=CtmiRNA−CtU6. Synthetic miR-124-3p mimics (124M), miR-124-3p inhibitor (124I), and negative control (NC) were purchased from GenePharma (Shanghai, China). The transfections were carried out with Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s specifications.
5
Quantification of Extracellular miRNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MiRNAs were isolated using miRNeasy FFPE Kit (QIAGEN, Netherland) for FFPE samples and Total Exosome RNA and Protein Isolation Kit (Thermo Fisher Scientific) for extracellular vesicles. cDNAs were generated using the TaqMan MicroRNA Reverse Transcription Kit (Thermo Fisher Scientific). Gene-specific TaqMan MicroRNA probes (Thermo Fisher Scientific) were utilized for quantitative analyses of miRNA transcript levels of miR-10a, miR-28, miR-99b, miR-141, miR-320b, and miR-3120. Cel-miR-39 was used as internal references. Polymerase chain reactions (PCR) were performed using StepOne (Thermo Fisher Scientific), and relative expression levels were calculated using the 2−ΔΔCT method.
6
Quantifying miR-29c-3p and LIF Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using Trizol (Invitrogen, USA) reagent. qRT-PCR of miR-29c-3p was performed with TaqMan microRNA probes (Thermo Scientific, USA) based on the instructions. The expression of miR-29c-3p was assayed by TaqMan® small RNA assay kit (Thermo Scientific, USA). The relative miR-29c-3p levels were normalized to U6 and analyzed with 2–ΔΔCt method.
For LIF quantification, the extracted RNA was reverse transcribed into cDNA using the PrimeScript™ RT reagent Kit (Takara, Japan). Quantitative PCR analyses were performed on LightCycler® 480 System (Roche) using the SYBR Green assay (Takara, Japan). The relative RNA level of LIF was normalized against β-actin and 2–ΔΔCt method was used for analysis. Primers used in this study are listed inTable 1 .
For LIF quantification, the extracted RNA was reverse transcribed into cDNA using the PrimeScript™ RT reagent Kit (Takara, Japan). Quantitative PCR analyses were performed on LightCycler® 480 System (Roche) using the SYBR Green assay (Takara, Japan). The relative RNA level of LIF was normalized against β-actin and 2–ΔΔCt method was used for analysis. Primers used in this study are listed in
The Primer Sequences for qRT-PCR
| Gene | Forward | Reverse |
|---|---|---|
| Human LIF | CCAACGTGACGGACTTCCC | TACACGACTATGCGGTACAGC |
| Mouse LIF | ATTGTGCCCTTACTGCTGCTG | GCCAGTTGATTCTTGATCTGGT |
| Human β-actin | CATGTACGTTGCTATCCAGGC | CTCCTTAATGTCACGCACGAT |
| Mouse β-actin | AGTGTGACGTTGACATCCGTA | GCCAGAGCAGTAATCTCCTTCT |
7
Quantifying Mature miRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Assays to quantify mature miRNAs were conducted as previously described with slight modifications [26 (link), 27 (link)]. Total RNA was extracted from the cultured cells and tissues using TRIzol Reagent (Invitrogen) according to the manufacturer’s instructions. miR-522 determination was performed using Taqman microRNA probes (Catalog number: 4427975, ThermoFisher, US). All of the reactions were run in triplicate. After the reactions were complete, the cycle threshold (CT) data were determined using fixed threshold settings, and the mean CT was determined from triplicate PCRs. A comparative CT method was used to compare each condition to the control reactions. U6 snRNA was used as an internal control of miRNAs, and mRNA levels were normalized to GAPDH. The relative amount of gene normalized to control was calculated with the eq. 2-ΔCT, in which ΔCT = CT gene-CT control.
8
Quantitative Analysis of miRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from PFC and hippocampus samples using miRNeasy mini kit (QIAGEN) following the manufacturer’s protocol. Reverse transcription was performed using miRNA-specific primers (Applied Biosystems, Foster City, CA, USA). The resulting cDNA was diluted 1:2 prior to performing quantitative real-time PCR (qPCR). qPCR was performed in triplicate using Taqman microRNA probes (Applied Biosystems Inc, CA, USA) following the manufacturer’s protocol.
9
Quantitative Analysis of miRNA, Src, and GAPDH
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from the frozen tissue specimens and cultured cells was isolated with TRIzol Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. Mature miRNA was quantified by virtue of Taqman microRNA probes (Applied Biosystems, Foster City, CA) according to the manufacturer's instructions.
To quantify Src and GAPDH mRNA, RT products including SYBR Green (TAKARA, China) and designed primers for Src and GAPDH were utilized. The primer sequence was as follows: Src (forward primer): 5′‐TGGCAAGATCACCAGACGG‐3′; Src (reverse primer): 5′‐GGCACCTTTCGTGGTCTCAC‐3′; GAPDH (forward primer): 5′‐CTGGGCTACACTGAGCACC‐3′; and GAPDH (reverse primer): 5′‐AAGTGGTCGTTGAGGGCAATG‐3′.
To quantify Src and GAPDH mRNA, RT products including SYBR Green (TAKARA, China) and designed primers for Src and GAPDH were utilized. The primer sequence was as follows: Src (forward primer): 5′‐TGGCAAGATCACCAGACGG‐3′; Src (reverse primer): 5′‐GGCACCTTTCGTGGTCTCAC‐3′; GAPDH (forward primer): 5′‐CTGGGCTACACTGAGCACC‐3′; and GAPDH (reverse primer): 5′‐AAGTGGTCGTTGAGGGCAATG‐3′.
10
TRIzol-based miRNA and mRNA Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the cultured cells and tissues using TRIzol Reagent (Invitrogen) following the manufacturer's protocol. The quantity of miRNA was performed using Taqman microRNA probes (Applied Biosystems, Foster City, CA). After the reactions were accomplished, the cycle threshold (CT) data were determined using fixed threshold settings, and the mean CT was calculated from triplicate PCRs. A comparative CT method was used to compare each condition to the control reactions. U6 snRNA was used as an internal control of miRNAs, and the mRNA levels of TGFβR2 was normalized to the corresponding housekeeping gene GAPDH. The relative amount of gene normalized to control was calculated with the equation 2−ΔCT, in which ΔCT = CT gene − CT control. All of the reactions were run in triplicate. Primers of TGFβR2 and GAPDH were as follows:
5′-AGAAGGCTGGGGCTCATTTG-3′ (GAPDH, sense);5′-AGGGGCCATCCACAGTCTTC-3′ (GAPDH, antisense);
5′-GTAGCTCTGATGAGTGCAATGAC-3′ (TGFβR2, sense);
5′-CAGATATGGCAACTCCCAGTG-3′ (TGFβR2, antisense).
5′-AGAAGGCTGGGGCTCATTTG-3′ (GAPDH, sense);5′-AGGGGCCATCCACAGTCTTC-3′ (GAPDH, antisense);
5′-GTAGCTCTGATGAGTGCAATGAC-3′ (TGFβR2, sense);
5′-CAGATATGGCAACTCCCAGTG-3′ (TGFβR2, antisense).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!