Dna thermal cycler

RT-PCR was performed as reported previously [30 (link)]. For qPCR, the PCR mixture was amplified in a DNA thermal cycler (Applied Biosystems, Waltham, MA, USA) for 35 cycles and the products were identified on a 2% agarose gel electrophoresis containing ethidium bromide. The respective primers were procured from Integrated DNA Technologies (Supplementary Table S2). Images were captured by a UVI gel documentation system and intensity was measured by Image J software.

RNA samples were prepared using the TriPure reagent according to the manufacturer’s protocol (Roche, Basel, Switzerland). BNIP3 levels were analysed by real time RT-PCR and normalized to that of the housekeeping gene, β-actin, as an internal control. Briefly, first-strand cDNA was synthesised from 6 μg of total RNA at 37 °C for 60 min using MMLV high-performance reverse transcriptase (MM070150; Epicentre, Madison, WI, USA). For real-time PCR, a Roche LightCycler Nano (Roche) and iQ™ SYBR^® Green Supermix (Bio-Rad Laboratories, Inc., Hercules, CA, USA) were used. cDNA was amplified using specific primers. The primer sets were as follows: AhR (sense, 5′-GGCTTGGAATTACAGGAATCC-3′, antisense, 5′-CAGCCTCAGGATGTGAACTC-3′), BNIP3 (sense, 5′-GCTCCCAGACACCACAAGAT-3′, antisense, 5′-TGAGAGTAGCTGTGCGCTTC-3′), LC3 (sense, 5′-ATGCCGTCGGAGAAGAC CTT-3′, antisense, 5′-TTACACTGACAATTTCATCCCG-3′), GADPH (sense, 5′-ACCCA GAAGACTGTGGATGG-3′, antisense, 5′-CAGTGAGCTTCCCGTTCAG-3′) on a DNA thermal cycler (Applied Biosystems, Foster City, CA, USA) using the following program: denaturation for 5 min at 95 °C, followed by 35 cycles of denaturation for 30 s at 95 °C, annealing for 30 s at 55 °C, and extension for 40 s at 72 °C, with a final extension for 10 min at 72 °C. The PCR products were separated by 1.5% agarose gel electrophoresis and visualized by ethidium bromide staining.

Total genomic DNA was isolated from whole blood (2 ml) with EDTA as the anticoagulant, using a blood DNA isolation kit (Maxim Biotech Inc., San Francisco, CA, USA). DRD2 TaqI B expression was determined by PCR-restriction fragment length polymorphism as reported previously [20 (link)]. In brief, forward (5′-GATACCCACTTCAGGAAGTC-3′) and reverse (5′-GATGTGTAGGAATTAGCCAGG-3′) primers were used to amplify a 459 bp fragment. The reaction was carried out in a DNA thermal cycler (Applied Biosystems, Norwalk, CT, USA) as follows: denaturation at 94 °C for 4 min, 35 cycles of maintenance at 94 °C for 30 s, annealing at 58 °C for 30 s, and primer extension at 72 °C for 30 s; and a final extension step at 72 °C for 5 min. The PCR products were digested with Taq I, and analyzed on 3 % agarose gel (NuSieve 3:1, FMC Bioproduct, Rockland, ME, USA) containing ethidium bromide. One (459 bp), three (459, 267 and 192 bp) and two (267 and 192 bp) fragments were seen for B1/B1, B1/B2 and B2/B2 genotypes, respectively. Subjects were divided into three groups according to their DRD2 TaqI B polymorphisms. The Taq1B polymorphism would be referred to by the number rs1079597 and the alleles referred to as A/G or T/C depending on the strand the genotype assay targets [21 (link), 22 ].

GAS7C mRNA expression were measured by multiplex RT–PCR analysis using the β-actin gene as an internal control. The primers for the RT-PCR were as follows: GAS7C-F 5′- CGAGCTACGTGCAGTTGCT -3′; GAS7C-R 5′ -CATGTGGGCAGTCTCTGGAG- 3′; β-actin-F 5′- GGCGGCACCACCATGTACCCT -3′; β-actin-R 5′- AGGGGCCGGACTCGTCATACT -3′. Reactions were carried out in a final volume of 25 μl with 1 μl of cDNA and 0.25 pmol of primers in a DNA Thermal Cycler (PE Applied Biosystems, Foster City, CA). The relative levels of gene expression were calculated as previously described [37 (link)].