The IDV screening was performed from 696 respiratory outbreaks in 725 bovine farms in Northern Italy. From January 2018 to May 2019, 936 samples (664 nasal swabs, 250 lung tissues and 22 bronchoalveolar fluids) were collected by field veterinarians for diagnostic purposes during bovine respiratory outbreaks in the Italian regions of Piemonte, Lombardia, Emilia Romagna, Veneto, Trentino Alto Adige and Friuli Venezia Giulia. The specimens were refrigerated at 4 °C prior to analysis. RNA extraction was performed generally within 48 h from sampling but if tests were delayed for more than 2 days, specimens were frozen at −70 °C. Viral RNA was extracted from clinical samples using One-For-All Vet Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions and RT-PCR was performed targeting IDV PB1 gene [18 (link)]. PCR was performed by using QIAGEN Quantifast Probe RT-PCR kit+IC with IDV F (5′TGGATGGAGAGTGCTGCTTC′), IDV R (3′GCCAATGCTTCCTCCCTGTA3′) and IDV Probe (FAM-CATGTTAAACATTCCCATCAGCATTCCT −BHQ1). Retrotranscription step was at 50 °C for 20 min followed by 95 °C for 5 min; PCR reaction was performed with 45 cycles of 15 s at 94 °C, 60 s at 60 °C followed by fluorescence detection. The analytical cutoff for positivity was established at Ct value of 38.
Quantifast probe rt pcr kit
Manufactured by Qiagen
Sourced in Germany
The QuantiFast Probe RT-PCR kit is a fast, real-time reverse transcription PCR (RT-PCR) assay that enables sensitive and reliable quantification of RNA targets. The kit includes all necessary components for reverse transcription and PCR amplification, including a fast-cycling enzyme mix and optimized buffer system.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (4 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (4 mentions)
Universal rna purification kit, by EURx (3 mentions)
Stratagene mx4000 real time qpcr system, by Agilent Technologies (3 mentions)
Rnalater, by Merck Group (2 mentions)
Rneasy plus mini kit, by Qiagen (2 mentions)
Magna pure lc total nucleid acid isolation kit, by Roche (2 mentions)
Lightcycler 480 real time pcr system, by Roche (2 mentions)
Magna pure 96 system, by Roche (2 mentions)
One for all vet kit, by Qiagen (1 mentions)
Mx3000p qpcr system, by Agilent Technologies (1 mentions)
High pure viral nucleic acid kit, by Roche (1 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (1 mentions)
Direct zoltm rna miniprep kit, by Zymo Research (1 mentions)
Quantstudio 5 system, by Thermo Fisher Scientific (1 mentions)
Taqman r gene expression assay, by Thermo Fisher Scientific (1 mentions)
Quantstudio 3 real time pcr system, by Qiagen (1 mentions)
C1000 thermal cycler, by Bio-Rad (1 mentions)
Qiaamp viral rna kit, by Qiagen (1 mentions)
Tissuelyser 2 homogenizer, by Qiagen (1 mentions)
21 protocols using quantifast probe rt pcr kit
1
IDV Screening in Bovine Respiratory Outbreaks
2
Quantification of Wound Tissue Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the wound tissues preserved in RNAlater (Sigma Aldrich) using Universal RNA Purification Kit (EURx, Gdansk, Poland). Transcripts of TNF-α, VEGF-α, PDGF-β, IL-1α and TGF-β1 were quantified using Taqman Gene Expression Assays (Thermo Fisher Scientific). All PCR reactions were carried out with QuantiFast Probe RT-PCR Kit (Qiagen, Hilden, Germany) using a real-time PCR instrument Stratagene MX4000 Real-Time qPCR System (Agilent Technologies) according to the manufacturer’s protocol. The 2-∆∆Ct method was used in calculating the relative ratio to control uninfected tissue.
3
Quantitative Detection of SARS-CoV-2 Subgenomic RNA
4
Quantifying Antiviral Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cells using Universal RNA Purification Kit (Eurx). Transcripts of IFN-α, CXCL9, CXCL10, TNF-α, and GADPH were quantified using TaqMan® Gene Expression Assays (Thermo Fisher Scientific). All PCR reactions were carried out with QuantiFast Probe RT-PCR Kit (QIAGEN, Hilden, Germany) using a real-time PCR instrument Stratagene MX4000 Real-Time qPCR System (Agilent Technologies) according to the manufacturer's protocol. The 2−∆∆Ct method was used in calculating the relative ratio to control uninfected tissue.
5
Quantitative Real-time RT-PCR of Plg in Mouse Liver
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the mouse liver using an RNeasy plus mini kit (Qiagen, Hilden, Germany). Quantitative real-time RT-PCR was performed using a QuantiFast Probe RT-PCR kit (Qiagen) with the predesigned primer and probe sets for mouse Plg and Rn18s (reference gene), according to the manufacturer’s instructions. Amplification and quantification were performed using an Mx 3000P QPCR system (Agilent Technologies). Each RNA sample was analyzed in triplicate. The Plg mRNA levels in wild-type mice were defined as 100%.
6
Foot-and-Mouth Disease Virus Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All OPF, heparinised blood, urine and faeces suspension samples were tested for presence of FMDV by plaque count on monolayers of secondary lamb kidney cells (virus isolation, VI). Samples were tested in 2 wells of a six-well plate using 200 μL per well, as previously described [20 (link)]. All OPF samples were also tested for presence of FMDV by RT-PCR. RNA isolation was performed using the Magna Pure LC total Nucleid Acid Isolation kit® (Roche) and the MagNa Pure 96 system® (Roche). Isolated RNA was tested in a LightCycler 480 Real-Time PCR System® (Roche) using a QuantiFast Probe RT-PCR kit® (Qiagen), all in accordance with the manufacturers’ instructions. The primers, probes and test protocol used have been previously described [21 (link)].
7
One-step RT-PCR for NDV Detection
8
Nucleic Acid Extraction and MERS-CoV Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total nucleic acids were purified from a 200 μl sample using High Pure Viral Nucleic Acid kit (Roche, Germany) according to the manufacturer's instructions. Each sample was tested independently in a 25 μl reaction for influenza A/B and MERS-CoV using QuantiFast Probe RT-PCR Kit (Qiagen, Germany). MERS-CoV was tested with targeting the upstream region of the E gene (UpE) for screening and the open reading frame 1b for confirmation [9] .
9
Quantitative Analysis of hTERT Expression in Tumor Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of tumor cells was extracted at 24 h after treatment with baicalein or baicalin using an RNeasy Mini kit (Qiagen) and then used for reverse transcription according to the manufacturer's instruction. The sequences of the primers for human telomerase reverse transcriptase (hTERT) are as follows: 5′ ATGCGACAGTTCGTGGCTCA 3′ (forward) and 5′ ATCCCCTGGCACTGGACGTA 3′ (reverse). The quantification of real-time PCR products was performed using QuantiFast Probe RT-PCR Kit (Qiagen). The housekeeping gene GAPDH was used as internal control for RNA integrity and normalization.
10
Detection of FMDV in Biological Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All oral swab, heparinised blood, urine, and faeces samples were tested for the presence of FMDV as described previously [11 (link)], using plaque titration on monolayers of secondary lamb kidney cells (VI, i.e. detection of infectious virus particles). In addition all oral swab and probang samples were tested for the presence of FMDV using real time RT-PCR because in these samples neutralising antibodies, that could influence the virus isolation results, were expected to be present. RNA isolation was performed using the Magna Pure LC total Nucleid Acid Isolation kit (03 038 505) in the MagNa Pure 96 system (Roche®, Mannheim, Germany). Isolated RNA was tested as described previously [19 (link)] using a LightCycler 480 Real-Time PCR System (Roche®) with the exception that we used a Quantifast Probe RT-PCR Kit (Qiagen®, Venlo, The Netherlands).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!