Hifair 3 1st strand cdna synthesis supermix kit

Total RNA (1 ug) from samples in the PT and PT+EE groups were extracted and converted into cDNA with the Hifair^™ III 1st Strand cDNA Synthesis SuperMix Kit (YEASEN) in a total volume of 20 µL. Quantitative PCR was performed on the Quantstudio^™ Real-Time PCR System (Thermo Fisher) in a final reaction volume of 10 μL, using 50 ng of the cDNA template from each sample. GAPDH served as the housekeeping control. Reactions were performed in triplicate with a minimum of three independent runs. Data were analyzed using the ΔΔCt method on Quantstudio^™ Real-Time (RT) PCR software (Thermo Fisher). Primer sequences are displayed in Table1.

Leaves and flowers were sampled from 5-week-old B. juncea plants and were immediately frozen in liquid nitrogen. Total RNA was extracted from the samples using the Biospin Plant Total RNA Extraction Kit (BioFlux) following the manufacturer’s instructions. Genomic DNA (gDNA) was digested in a 15-μl reaction mixture containing 3 μl 5× gDNA Digester Mix, 6 μl total RNA, and 6 μl RNase-free H₂O, at 42°C for 2 min). The purified RNA was reverse-transcribed in a 20-μl reaction volume using the Hifair III 1st Strand cDNA Synthesis SuperMix Kit (YEASEN) in accordance with the manufacturer’s instructions. The reverse transcription thermal profile comprised 25°C for 5 min, followed by 55°C for 15 min and 85°C for 5 min. All cDNA samples were diluted with ddH₂O (1:4, v/v). The diluted cDNA was used directly for PCR amplification.
Based on the conserved sequences in the Brassica BRC1 genes, gene-specific primers (BRC1-F1, BRC1-F2, and BRC1-R1) were designed to amplify the BjuBRC1 genes in this study. Based on sequences of BjuBRC1-1, four truncated genes were subcloned by special primers. In addition, two BjuFT genes (BjuVB05G49700 and BjuVA07G33060) were cloned using the same procedure described above. All primers used are listed in Supplementary Table 1.

Total RNA was isolated from mouse heart tissues or HL-1 cardiomyocytes using TRIzol reagent (Invitrogen, USA). The RNA was reverse-transcribed into cDNA using the Hifair III 1st Strand cDNA Synthesis SuperMix kit (11141ES60, YEASEN, China). The diluted cDNA was then used for qRT-PCR using Hieff UNICON Universal Blue qPCR SYBR Green Master Mix (10 μL/well, HB200331, YEASEN, China) according to the amplification instructions. β-Actin was used as a housekeeping gene to normalize mRNA expression levels. The relative expression levels of Lnc Neat1 and the relative mRNA expression levels of NLRP3 and ASC were quantified by the 2^−ΔΔCT method. The primers used as followed: Lnc Neat1, 5′-GGC ACA AGT TTC ACA GGC CTA CAT GGG-3′ (forward) and 5′-GCC AGA GCT GTC CGC CCA GCG AAG-3′ (reverse); NLRP3, 5′-AGA AGA GAC CAC GGC AGA AG-3′ (forward) and 5′-CCT TGG ACC AGG TTC AGT GT-3′ (reverse); ASC, 5′-CTG ACG GAT GAG CAG TAC CA-3′ (forward) and 5′-AGT CCT TGC AGG TCC AGT TC-3′ (reverse); and β-actin, 5′-GTA GCC ATC CAG GCT GTG TT-3′ (forward) and 5′-ATG TCA CGC ACG ATT TCC CT-3′ (reverse).

Total RNA was extracted using TRIzol reagent (EX1880-100 ml; G-Clone, Beijing, China), followed by measuring the concentrations of RNA using a spectrophotometer. Then, RNA was reverse transcribed into cDNA using Hifair® III 1st Strand cDNA Synthesis SuperMix Kit (11141ES10; YEASEN, Shanghai, China) as per the instructions. Afterward, PCR amplification reaction was performed using Hifair® III One-Step RT-qPCR SYBR Green Kit (11143ES50; YEASEN, Shanghai, China) on ABI 7500 PCR system (Applied Biosystems, USA). The PCR thermal cycles were as listed: initial denaturation at 95°C for 10 minutes, 35 cycles of 95°C for 10 seconds and 65°C for 15 seconds. β-actin functioned as the internal control, and the related gene expression was measured by the 2^−ΔΔCT method [25 (link)]. The primers information was listed in Table 1.Table 1.

The sequences of all primers used in qRT-PCR

Gene name	Primer sequence
NF-κB	Forward: ATGGCTACTATGAGGCTGACCTC
	Reverse: TGCCGATGCACATCAGCTTGAG
TWEAK	Forward: GGAACACTCCAAAAACAGACCT
	Reverse: CCACCACTGGGTATTGAGTAGAA
β-actin	Forward: GTCCCTCACCCTCCCAAAAG
	Reverse: GCTGCCTCAACACCTCAACCC