Superscript 2 reagent

Manufactured by Thermo Fisher Scientific

Sourced in United States

Superscript II reagents are a set of reverse transcription products designed for cDNA synthesis from RNA templates. The reagents facilitate the conversion of RNA into complementary DNA (cDNA) for further downstream applications.

Automatically generated - may contain errors

Lab products found in correlation

Nanodrop 2000c uv vis spectrophotometer, by Thermo Fisher Scientific (4 mentions) Rneasy mini kit, by Qiagen (4 mentions) Trizol, by Thermo Fisher Scientific (4 mentions) Evagreen, by Bio-Rad (3 mentions) Cfx96 real time pcr detection system, by Bio-Rad (3 mentions) Sybr green chemistry, by Thermo Fisher Scientific (2 mentions) Abi 7000 sequence detection system, by Thermo Fisher Scientific (2 mentions) Sybr green master mix, by Thermo Fisher Scientific (2 mentions) Rnase free dnase, by Roche (1 mentions) Rna stat 60, by Tel-Test (1 mentions) Tri reagent, by Molecular Research Center (1 mentions) Sybr green, by Qiagen (1 mentions) Experion automated electrophoresis system, by Bio-Rad (1 mentions) Trizol, by Merck Group (1 mentions) Nucleospin rna plus kit, by Macherey-Nagel (1 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions) Syber green mix, by Bio-Rad (1 mentions) Rneasy kit, by Qiagen (1 mentions)

12 protocols using superscript 2 reagent

Quantification of Corticotropin-Releasing Factor

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

These procedures have been described in detail before (Cabral et al., 2012 (link)). Corticosterone plasma concentration was measured using an ELISA kit according to the manufacturer’s protocol (Assay Designs). For the CRF mRNA levels quantification, total RNA from PVN punches was isolated and quantified by absorbance at 260 nm. Total RNA was reverse-transcribed into cDNA with random hexamer primers and SuperScript II reagents (Invitrogen). Quantitative PCR was performed using SYBR-green chemistry (Applied Biosystems). The CRF mRNA levels are calculated by the comparative threshold cycle method and expressed relative to the housekeeping gene Cyclophilin A. Standard curves for CRF and Cyclophilin A transcript levels were generated using hypothalamic cDNA of mouse. Primer sequences for CRF: Sense: 5′-TCTGGATCTCACCTTCCACCT-3′, Antisense: 5′-CCATCAGTTTCCTGTTGCTGT-3′. Primer sequences for Cyclophilin A: Sense: 5′-TGGTCTTTGGGAAGGTGAAAG-3′, Antisense: 5′-TGTCCACAGTCGGAAATGGT-3′. Averaged levels of CRF normalized to Cyclophilin A in each experimental group were compared with similar values obtained from vehicle-treated mice to determine relative expression levels.

Cabral A., Portiansky E., Sánchez-Jaramillo E., Zigman J.M, & Perello M. (2016). GHRELIN ACTIVATES HYPOPHYSIOTROPIC CORTICOTROPIN-RELEASING FACTOR NEURONS INDEPENDENTLY OF THE ARCUATE NUCLEUS. Psychoneuroendocrinology, 67, 27-39.

+ Open protocol

+ Expand

Quantifying GHSR mRNA Expression in Mouse ARC

Check if the same lab product or an alternative is used in the 5 most similar protocols

We euthanized ad libitum–fed and 48 h–fasted mice by live decapitation. We extracted brains, placed them briefly in cold diethylpyrocarbonate-PBS, and excised small punches of tissue corresponding to the ARC, as explained above. We then performed qRT-PCR analysis as described in Chuang et al. (2011a) (link). In brief, we isolated total RNA from these punches using RNA STAT-60 (Tel-Test, Inc.). We treated the RNA with RNase-free DNase (Roche) and reverse-transcribed it into cDNA with SuperScript II reagents (Invitrogen). We performed a quantitative PCR using a sequence detection system (7900HT; Applied Biosystems) and SYBR green chemistry (Applied Biosystems). Primers were mGHSR-QF1, 5′-ACCGTGATGGTATGGGTGTCG-3′, and mGHSR-QR1, 5′-CACAGTGAGGCAGAAGACCG-3′; they amplified a product within exon 2 of the ghsr gene. We confirmed these results by a second set of specific primers, one of which is located in exon 1 of the ghsr gene (mGHSR-QF3, 5′-ATCTCCAGTGCCAGGCACTGCT-3′) and the other of which is located in exon 2 (mGHSR-GR3, 5′-AATGGGCGCGAGCAGCAGGAA-3′) of the ghsr gene. The mRNA relative levels were expressed relative to the housekeeping gene 36B4 and calculated by the comparative threshold cycle (ΔΔCt) method (Kurrasch et al., 2004 (link)). The data are presented as a percentage of levels observed in wild-type ARC punches.

López Soto E.J., Agosti F., Cabral A., Mustafa E.R., Damonte V.M., Gandini M.A., Rodríguez S., Castrogiovanni D., Felix R., Perelló M, & Raingo J. (2015). Constitutive and ghrelin-dependent GHSR1a activation impairs CaV2.1 and CaV2.2 currents in hypothalamic neurons. The Journal of General Physiology, 146(3), 205-219.

+ Open protocol

+ Expand

Circadian Liver RNA Transcript Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Freshly liver samples isolated at the indicated circadian time points (ZT) were used for total RNA isolation using TRI reagent (Molecular Research Center). The RNA quality was checked by gel electrophoresis and spectrophotometric analysis (280/260 nm). One microgram of total RNA was reverse-transcribed using random hexamers and Superscript II reagents (Invitrogen) as per manufacturer instructions. The synthesized DNA was used for qRT-PCR and amplified using gene-specific forward and reverse primers (from two adjacent exons) with SYBR green (QIAGEN) and expressed relative to the glyceraldehyde 3-phosphate dehydrogenase (GAPDH) RNA levels, as previously described (26 (link)). At each time point, three mice were sacrificed for RNA transcript determination, and all experiments were replicated at least three times.

Misra N., Damara M, & Chambon P. (2023). The HP1α protein is mandatory to repress the circadian clock and its output genes during the 12 h period of transcriptional repression. Proceedings of the National Academy of Sciences of the United States of America, 120(8), e2213075120.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Retinal Degeneration

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Quantitative RT-PCR experiment was performed on two independent biological replicates from WT and rd10 retinas at each stage (P10, P20, P30, and P120). Each sample was a pool of retinas from at least three individuals. Total RNA was extracted from neural retina using RNeasy mini kit (Qiagen, Germantown, MD, USA) and treated with DNAse I according to the manufacturer's instructions. RNA quantity and quality were assessed using the NanoDrop 2000c UV-Vis spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) and Experion automated electrophoresis system (Bio-Rad, Hercules, CA, USA). One microgram of total RNA was reverse transcribed in the presence of oligo-(dT)20 using Superscript II reagents (Thermo Fisher Scientific). For each RT-qPCR, 2 μL of a 10-fold dilution of the cDNA was used, and the reactions were performed in triplicates on a 7900HT Genetic Analyzer (Thermo Fisher Scientific) as previously described.^{37 (link)} Differential expression analysis was performed using the ΔΔCt method using the geometric average of Gak, Mrpl46, Srp72, and Tbp as the endogenous controls.³⁸ For each gene, the relative expression of each samples was calculated using WT retina at each time point as the reference (1 arbitrary unit [a.u.]). Primers are listed in Supplementary Table S1.

Hamon A., Masson C., Bitard J., Gieser L., Roger J.E, & Perron M. (2017). Retinal Degeneration Triggers the Activation of YAP/TEAD in Reactive Müller Cells. Investigative Ophthalmology & Visual Science, 58(4), 1941-1953.

+ Open protocol

+ Expand

Osteogenic Differentiation of iPSC-MSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mineralized films were held in place with Teflon O-rings for differentiation assays to prevent films from floating. Films were incubated in peptide solution(100 μg mL⁻¹) for 3 hrs. iPS-MSCs were plated (15,000 cells cm⁻²) and grown to confluence until differentiated in complete media containing osteogenic factors (10⁻⁸M Dexamethasone, 2–5mM β-glycerophosphate, 10⁻⁴ M ascorbic acid). Cells were differentiated for 0, 3, 7, 10, 14, 21, 28 days and collected (n=3) in TRIZOL® (ThermoFisher Scientific). Cells were homogenized in TRIZOL®, phase-separated in chloroform, and RNA was precipitated in 500μL isopropanol, washed in 80% ethanol, dried and dissolved in RNA grade double distilled water (Milipore) at 70^oC. The amount of RNA was measured using a spectrophotometer and 1μg was used for reverse transcription using SuperScript II reagents (ThermoFisher Scientific). TaqMan® Universal PCR Master Mix and Taqman primer probes RUNX2 (Hs01047973_m1), OSX(Hs01866874_s1), ALP(Hs03674916_s1), OCN(Hs01587814_g1) were used for qRT-PCR reactions. Cycle threshold (C_T) values for each gene of interest(GOI) were normalized to GAPDH expression to attain ΔC_T and day zero values were used as a baseline to attain ΔΔC_T.^{[44 (link)]} Fold changes (2^{- ΔΔCT}) are depicted in Figure 4, delta-delta C_T (ΔΔC_T) values were used for statistical analysis.

Ramaraju H, & Kohn D.H. (2019). Cell and Material-Specific Phage Display Peptides Increase iPS-MSC Mediated Bone and Vasculature Formation In Vivo. Advanced healthcare materials, 8(9), e1801356.

+ Open protocol

+ Expand

RT-qPCR Analysis of Retinal Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RT-qPCR experiment was performed on at least three mice per condition. Total RNA was extracted from a single retina using RNeasy mini kit (Qiagen) according to the manufacturer’s instructions. RNA quantity was assessed using the NanoDrop 2000c UV-Vis spectrophotometer (Thermo Fisher Scientific). Total RNA (500 ng) was reverse transcribed in the presence of oligo-(dT)20 using Superscript II reagents (Thermo Fisher Scientific). For each RT-qPCR, cDNA was used in the presence of EvaGreen (Bio-Rad), and the reactions were performed in triplicates on a CFX96 Real-Time PCR Detection System (Bio-Rad). Differential expression analysis was performed using the ∆∆Ct method and normalised using the geometric mean expression of two housekeeping gene, Rps26 and Srp72²⁵. For each gene, the relative expression in each sample was calculated using the mean of the controls as the reference (1 a.u.). Primers used are listed in Supplementary Table S1.

Masson C., García-García D., Bitard J., Grellier É.K., Roger J.E, & Perron M. (2020). Yap haploinsufficiency leads to Müller cell dysfunction and late-onset cone dystrophy. Cell Death & Disease, 11(8), 631.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis in Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

RT-qPCR experiment was performed on at least three mice per condition. Total RNA was extracted from a single retina using RNeasy mini kit (Qiagen) and treated with DNAse I according to the manufacturer's instructions. RNA quantity was assessed using the NanoDrop 2000c UV-Vis spectrophotometer (Thermo Fisher Scientific). Total RNA (500 ng) was reverse transcribed in the presence of oligo-(dT)20 using Superscript II reagents (Thermo Fisher Scientific). For each RT-qPCR, cDNA was used in the presence of EvaGreen (Bio-Rad), and the reactions were performed in triplicates on a CFX96 Real-Time PCR Detection System (Bio-Rad). Differential expression analysis was performed using the ∆∆Ct method and normalized using the geometric mean expression of two housekeeping gene, Rps26 and Srp72 (Vandesompele et al., 2002) . For each gene, the relative expression in each sample was calculated using the mean of the controls as the reference (1 a.u.). Primers used are listed in Supplementary Table S1.

Masson C., García-García D., Bitard J., Grellier E., Roger J.E., & Perron M. (2020). Yap haploinsufficiency leads to Müller cell dysfunction and late-onset cone dystrophy.

+ Open protocol

+ Expand

Quantitative RT-PCR for Mouse and Xenopus

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from mouse neural retina or whole Xenopus tadpoles using RNeasy mini kit (QIAGEN) or NucleoSpin RNA Plus kit (Macherey Nagel), respectively. RNA concentration was assessed using the NanoDrop 2000c UV-Vis spectrophotometer (Thermo Fisher Scientific). Total RNA was reverse transcribed in the presence of oligo-(dT)20 using Superscript II reagents (Thermo Fisher Scientific). For each RT-qPCR reaction, 1.5 ng of cDNA was used in triplicates in the presence of EvaGreen (Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad). Differential expression analysis was performed using the DDCt method using the geometric mean of Rps26, Srp72 and Tbp as endogenous controls (Vandesompele et al., 2002) for mouse genes, and of Rpl8 and Odc1 as endogenous controls for Xenopus genes. Relative expression of each gene in each sample was calculated using the mean of the controls as the reference (1 a.u.). Primers are listed in Table S2. RT-qPCR experiments were performed on at least 5 mice or 3 tadpoles per condition, allowing for statistical analysis.

Hamon A., García-García D., Ail D., Bitard J., Chesneau A., Dalkara D., Locker M., Roger J.E, & Perron M. (2019). Linking YAP to Müller Glia Quiescence Exit in the Degenerative Retina. Cell reports, 27(6).

+ Open protocol

+ Expand

Quantifying AdipoR1 and AdipoR2 mRNA Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols

mRNA levels of AdipoR1 and AdipoR2 in tumor tissues and surrounding normal renal tissue were measured using qRT- PCR. Total RNA was extracted from the tissues using TRIzol^™ reagent (Invitrogen), and cDNA was synthesized using SuperScript^® II reagent (Invitrogen) according to the manufacturer’s instructions. The following primers were used: AdipoR1 forward 5′- AATTCCTGAGCGCTTCTTTCCT -3′ and reverse 5′- CATAGAAGTGGACAAAGGCTGC -3′, AdipoR2 forward 5′- TGCAGCCATTATAGTCTCCCAG -3′ and reverse 5′- GAATGATTCCACTCAGGCCTAG -3′, and β-actin forward 5′-ATCTGGCACCACACCTTCTA-3′ and reverse 5′-CGTCAT ACTCCTGCTTGCTGATCCACATCTGC-3′. The qRT-PCR conditions were as follows: 95°C for 30 s, 40 cycles of 95°C for 30 s and 60°C for 30 s, 95°C for 15 s, 60°C for 30 s, and 95°C for 15 s. Relative mRNA expression levels were determined using the 2-ΔΔCT method [5 (link)], and β-actin was used as an endogenous control. Each experiment was conducted in triplicate.

Ito R., Narita S., Huang M., Nara T., Numakura K., Takayama K., Tsuruta H., Maeno A., Saito M., Inoue T., Tsuchiya N., Satoh S, & Habuchi T. (2017). The impact of obesity and adiponectin signaling in patients with renal cell carcinoma: A potential mechanism for the “obesity paradox”. PLoS ONE, 12(2), e0171615.

+ Open protocol

+ Expand

Quantitative Analysis of Stem Cell Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated by TRIzol (Invitrogen, Carlsbad, CA, USA) following a standard procedure and was subjected to qRT-PCR with SuperScript II reagent (Invitrogen). The product was mixed with SYBR® Green Master Mix (Applied Biosystems, Foster City, CA, USA); the specific primers used were as follows: (SOD2, F:5′-GGCCTACGTGAACAACCTGAA, R:5′-CTGTAACATCTCCCTTGGCCA; CD133, F:5′-TCCACAGAAATTTACCTACATTGG, R:5′-CAGCAGAGAGCAGATG.
ACCA; Bmi-1, F:5′-TGGAGAAGGAATGGTCCACTTC, R:5′-GTGAGGAAACTGT.
GGATGAGGA; SOX2, F:5′-AAATGGGAGGGGTGCAAAAGAGGAG,R:5′-CAGCT.
GTCATTTGCTGTGGGTGATG; GAPDH, F:5′-GAAGGTGAAGGTCGGAGTC, R:5′-GAAGATGGTGATGGGATTC). The expression was detected using an ABI 7000 Sequence Detection System (Applied Biosystems) and was normalized to GAPDH using the 2^-ΔΔCT formula.

Chien C.H., Chuang J.Y., Yang S.T., Yang W.B., Chen P.Y., Hsu T.I., Huang C.Y., Lo W.L., Yang K.Y., Liu M.S., Chu J.M., Chung P.H., Liu J.J., Chou S.W., Chen S.H, & Chang K.Y. (2019). Enrichment of superoxide dismutase 2 in glioblastoma confers to acquisition of temozolomide resistance that is associated with tumor-initiating cell subsets. Journal of Biomedical Science, 26, 77.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!