Mutation surveyor software v 3

Manufactured by SoftGenetics

Sourced in United States

Mutation Surveyor software v.3.20 is a DNA sequence analysis tool developed by SoftGenetics. It is designed to detect and analyze mutations in DNA sequences. The software provides a user-friendly interface for visualizing and comparing DNA sequences, identifying sequence variations, and generating reports.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

Mutation Surveyor (114 citations) Mutation Surveyor software (101 citations)

16 protocols using mutation surveyor software v 3

Variant Validation and Confirmation in Genetic Studies

Check if the same lab product or an alternative is used in the 5 most similar protocols

We excluded variants with MAF > 0.5% in either the Exome Aggregation Consortium (ExAC) and/or the ICR1000 UK exome series. For the de novo analyses, we identified and validated any high-quality (as defined by OpEx¹⁸ (link)) variant in the child that was not present in either parent. We evaluated and validated all rare variants identified in the 14 genes.
We confirmed all small variants in Table S1 that were called in exomes via Sanger sequencing of M13-tagged PCR products generated from genomic DNA. We performed PCR using the QIAGEN Multiplex PCR Kit according to the manufacturer’s instructions. We sequenced PCR products using M13 sequencing primers, the BigDye Terminator Cycle Sequencing Kit, and an ABI 3730 Genetic Analyzer (Applied Biosystems). We analyzed sequences using Mutation Surveyor software v.3.20 (SoftGenetics) and verified the outputs by manual inspection by two individuals, independently.

Tatton-Brown K., Loveday C., Yost S., Clarke M., Ramsay E., Zachariou A., Elliott A., Wylie H., Ardissone A., Rittinger O., Stewart F., Temple I.K., Cole T., Mahamdallie S., Seal S., Ruark E, & Rahman N. (2017). Mutations in Epigenetic Regulation Genes Are a Major Cause of Overgrowth with Intellectual Disability. American Journal of Human Genetics, 100(5), 725-736.

+ Open protocol

+ Expand

PCR Product Purification and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCR products were enzymatically purified to remove residual primers and dNTPs using Illustra ExoProStar (GE Lifesciences) following the manufacturer's instructions. All sequencing reactions were carried out using the BigDye Terminator v.1.1 Cycle Sequencing Kit and were performed on a 3730 Genetic Analyzer (Life Technologies Ltd., Paisley, UK) according to the manufacturer's instructions. The sequencing data was analysed with reference to a control sequence trace using Mutation Surveyor software v.3.20 (SoftGenetics LLC, State College, PA, USA).

Burghel G.J., Hurst C.D., Watson C.M., Chambers P.A., Dickinson H., Roberts P, & Knowles M.A. (2015). Towards a Next-Generation Sequencing Diagnostic Service for Tumour Genotyping: A Comparison of Panels and Platforms. BioMed Research International, 2015, 478017.

+ Open protocol

+ Expand

TP53 Gene Mutation Profiling

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was extracted using proteinase K digestion followed by phenol/chloroform extraction as described by manufacture's recommendations. Primer sequences, product lengths and PCR conditions for the 11 exons of TP53 were retrieved from the IARC TP53 website [20] (link). Sanger sequencing was performed using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) according to the manufacturer's protocol using an ABI PRISM 3130 Genetic Analyzer (Applied Biosystems). Sequences were analysed using Mutation Surveyor software v3.20 (SoftGenetics).
Samples negative for TP53 mutations by Sanger sequencing were deep-sequenced to detect mutations present in a minority cell population. Indexed libraries of the PCR products were prepared using the Illumina Nextera XT kit with supplied protocol and sequenced using an Illumina MiSeq instrument, generating 2×150 bp reads with a mean coverage of 162x. Only sequences that passed quality control were analysed further. All sequence alterations were reviewed in the Integrative Genomics Viewer (IGV) version 2.3 [25] (link) and classified as missense, nonsense frameshift, in frame duplication, in frame deletion or splicing mutations by ANNOVAR [26] (link).

Maschietto M., Williams R.D., Chagtai T., Popov S.D., Sebire N.J., Vujanic G., Perlman E., Anderson J.R., Grundy P., Dome J.S, & Pritchard-Jones K. (2014). TP53 Mutational Status Is a Potential Marker for Risk Stratification in Wilms Tumour with Diffuse Anaplasia. PLoS ONE, 9(10), e109924.

+ Open protocol

+ Expand

Validating Exome Sequencing Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols

We used Sanger sequencing of M13 tagged-PCR products from genomic DNA to validate all variants identified in probands by exome sequencing and to confirm the absence in parental samples as appropriate. Primer hybridisation sequences used for PCR are given in Supplementary Material, Table S4. PCRs were performed using the Qiagen Multiplex PCR Kit according to the manufacturer's instructions. PCR products were sequenced using M13 sequencing primers, the BigDye Terminator Cycle Sequencing Kit and an ABI 3730 Genetic Analyser (Applied Biosystems). Sequences were analysed using Mutation Surveyor software v3.20 (SoftGenetics) and verified by manual inspection.

Loveday C., Tatton-Brown K., Clarke M., Westwood I., Renwick A., Ramsay E., Nemeth A., Campbell J., Joss S., Gardner M., Zachariou A., Elliott A., Ruark E., van Montfort R, & Rahman N. (2015). Mutations in the PP2A regulatory subunit B family genes PPP2R5B, PPP2R5C and PPP2R5D cause human overgrowth. Human Molecular Genetics, 24(17), 4775-4779.

+ Open protocol

+ Expand

Amplification and Sequencing of TP53 Gene

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA was subjected to PCR to amplify exons 5 to 9 of the TP53 gene by using the Tetrad 2 Peltier Thermal Cycler (Biorad, UK). Primers used: exon 5 forward (5 'ACGTGTGCCCTGACTTTCAAC T 3') and reverse (5' CAATCAGTGAGGAATCAGAGGC 3'). Exon 6 forward (5' TCAGATAGCGATGGTGAGCAG 3') and reverse (5' GCCACTGACAACCACCCTTA 3'). Exon 7 forward (5' AGGCGCACTGGCCTCATCTT 3') and reverse (5' GAAATCGGTAAGAGGTGGGC 3'). Exon 8 forward (5' GGAGTAGATGGAGCCTGGTTT 3') and reverse (5' GGTGATAAAAGTGAATCTGAGGC 3'). Exon 9 forward (5' GGAGACCAAGGGTGCAGTTAT 3') and reverse (5' GTTAGTTAGCTACAACCAGGAGCC 3'). Conditions for the reaction steps were an initial step of 94 0 C for 5 min followed by 35 cycles comprising of 94 0 C for 1 min for denaturation, 60 0 C for 1 min for annealing, 11 min at 72 0 C for elongation. Amplicons were prepared for sequencing using the BigDye Terminator Cycle Sequencing Kit. The products were run on an ABI automated sequencer (Applied Biosystems, CA, USA). Both DNA strands were sequenced. Mutation presence was confirmed by repeating the analysis. Sequence traces were analysed using Mutation Surveyor Software v3.20 (SoftGenetics, PA, USA).

Youssef G., Gillett C., Rampling D., Chagtai T., Virasami A., Barton J., Edwards D., Sebire N., Anderson J, & Montano X. (2019). The presence of Y674/Y675 phosphorylated NTRK1 via TP53 repression of PTPN6 expression as a potential prognostic marker in neuroblastoma. Human pathology, 86.

+ Open protocol

+ Expand

Direct Sequencing of PCR Amplicons

Check if the same lab product or an alternative is used in the 5 most similar protocols

Direct sequencing of PCR amplicons was carried out to confirm positive gene panel results. PCR was performed using Qiagen (Manchester, UK) master mix kit. Oligonucleotide primers for PCR amplification of targeted genomic DNA were designed using Primer3 software (http://frodo.wi.mit.edu/) and synthesised by Metabion International AG (Munich, Germany). Primer sequences are available on request. Following treatment with the Agencourt AMPure PCR purification system (Agencourt Bioscience, Beverly, Massachusetts, USA), products were sequenced using BigDye Terminator Cycle Sequencing kit (PE Applied Biosystems, Massachusetts, USA) and run on an ABI 3730xl capillary sequencer. Sequences were analysed using Mutation Surveyor software V.3.24 (SoftGenetics LLC, State College, Pennsylvania, USA).

Al-Hamed M.H., Kurdi W., Alsahan N., Alabdullah Z., Abudraz R., Tulbah M., Alnemer M., Khan R., Al-Jurayb H., Alahmed A., Tahir A.I., Khalil D., Edwards N., Al Abdulaziz B., Binhumaid F.S., Majid S., Faquih T., El-Kalioby M., Abouelhoda M., Altassan N., Monies D., Meyer B., Sayer J.A, & Albaqumi M. (2016). Genetic spectrum of Saudi Arabian patients with antenatal cystic kidney disease and ciliopathy phenotypes using a targeted renal gene panel. Journal of Medical Genetics, 53(5), 338-347.

+ Open protocol

+ Expand

Comprehensive Genetic Analysis of APP, PSEN1, and PSEN2

Check if the same lab product or an alternative is used in the 5 most similar protocols

In this study, we performed a systematic analysis of the entire coding region including flanking intron sequences of the genes APP, PSEN1 and PSEN2 by direct sequencing. The target fragments were amplified by polymerase chain reaction (PCR) using intronic primers designed from genomic sequence with the Primer 3 software. PCR products were purified by Exo/SAP digestion (Exonuclease I; New England; Beverly, MA; shrimp alkaline phosphatase; Promega, San Diego, CA, USA) and directly sequenced using ABI-PRISM BigDye® Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems) and the ABI-PRISM 3730 DNA Analyzer, as described by the manufacturer. Sequences were analyzed using Mutation Surveyor software v3.24 (SoftGenetics LLC, State College, PA). The primer sequences are listed in Additional file 12.

Hossini A.M., Megges M., Prigione A., Lichtner B., Toliat M.R., Wruck W., Schröter F., Nuernberg P., Kroll H., Makrantonaki E., Zoubouliss C.C, & Adjaye J. (2015). Induced pluripotent stem cell-derived neuronal cells from a sporadic Alzheimer’s disease donor as a model for investigating AD-associated gene regulatory networks. BMC Genomics, 16(1), 84.

+ Open protocol

+ Expand

Sanger Sequencing Validation of Genomic Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols

Sanger sequencing validation was performed for all de novo, novel and low quality metric variants (depth of coverage, base quality and mapping quality). Oligonucleotide primers for PCR ampli cation of targeted variants were designed using Primer3 software (http://frodo.wi.mit.edu/) and synthesized in house. The ampli ed PCR products were sequenced using an ABI 3730xl capillary sequencer (Applied Biosystems, CA, USA) and sequences were analysed using Mutation Surveyor software V.3.24 (SoftGenetics LLC, State College, Pennsylvania, USA).

Al-Hamed M.H., Kurdi W., Khan R., Tulbah M., AlNemer M., AlSahan N., AlMugbel M., Rafiullah R., Assoum M., Monies D., Shah Z., Rahbeeni Z., Derar N., Hakami F., Almutairi G., AlOtaibi A., Ali W., AlShammasi A., AlMubarak W., AlDawoud S., AlAmri S., Saeed B., Bukhari H., Ali M., Akili R., Alquayt L., Hagos S., Elbardisy H., Akilan A., Almuhana N., AlKhalifah A., Abouelhoda M., Ramzan K., Sayer J.A, & Imtiaz F. (2022). Prenatal exome sequencing and chromosomal microarray analysis in fetal structural anomalies in a highly consanguineous population reveals a propensity of ciliopathy genes causing multisystem phenotypes. Human genetics, 141(1).

+ Open protocol

+ Expand

Genetic Screening for Congenital Anomalies

Check if the same lab product or an alternative is used in the 5 most similar protocols

Using genomic DNA from affected fetuses, chromosomal microarray (CMA) testing was performed using the Affymetrix CytoScan assay platform according the manufacturer’s instructions. Given the known consanguinity, regions of homozygosity (ROH) > 2 Mb were used as surrogates of autozygosity to search for autosomal recessive causes of disease. Exome sequencing (ES), a technique for sequencing all of the protein-coding regions of the genome, using the Illumina HiSeq 2500 platform and TruSeq DNA exome capture with a ≥98% coverage of RefSeq and a >85% coverage of 20× read depth was performed. Downstream data analysis and subsequent filtering of variants by CAKUT candidate gene coordinates was performed in both families. Sanger sequencing validation was performed for identified candidate variants within homozygous regions. Oligonucleotide primers for PCR amplification of targeted variants were designed using Primer3 software (http://frodo.wi.mit.edu/ accessed on 17 May 2022) and synthesized in-house. The amplified PCR products were sequenced using an ABI 3730xl capillary sequencer (Applied Biosystems, Foster City, CA, USA), and sequences were analyzed using Mutation Surveyor software V.3.24 (SoftGenetics LLC, State College, PA, USA).

Al-Hamed M.H., Sayer J.A., Alsahan N., Edwards N., Ali W., Tulbah M, & Imtiaz F. (2022). Missense Variants in GFRA1 and NPNT Are Associated with Congenital Anomalies of the Kidney and Urinary Tract. Genes, 13(10), 1687.

+ Open protocol

+ Expand

Sanger Sequencing of DNMT3A Mutations

Check if the same lab product or an alternative is used in the 5 most similar protocols

We performed Sanger sequencing of PCR products from genomic DNA to confirm the mutations identified by exome sequencing, and to mutationally analyse the gene in the overgrowth series. We designed PCR primers to amplify the 22 coding exons and intron-exon boundaries of DNMT3A in 4 multiplex PCR reactions (Supplementary Table 1). The PCR was carried out using a Qiagen Multiplex PCR kit according to the manufacturer’s instructions. Products were sequenced with the original PCR primers or internal sequencing primers (exons 3, 6, 8, 10, 14 and 22) using the BigDye Terminator Cycle Sequencing Kit and an ABI 3730 Genetic Analyzer (Applied Biosystems, Foster City, CA,USA). Sequences were analyzed using Mutation Surveyor software v3.97 (SoftGenetics, State College, PA, USA), and verified by manual inspection. All mutations were confirmed by bidirectional sequencing of a second, independently amplified PCR product.

Tatton-Brown K., Seal S., Ruark E., Harmer J., Ramsay E., del Vecchio Duarte S., Zachariou A., Hanks S., O’Brien E., Aksglaede L., Baralle D., Dabir T., Gener B., Goudie D., Homfray T., Kumar A., Pilz D.T., Selicorni A., Temple I.K., Van Maldergem L., Yachelevich N., van Montfort R, & Rahman N. (2014). Mutations in the DNA methyltransferase gene, DNMT3A, cause an overgrowth syndrome with intellectual disability. Nature genetics, 46(4), 385-388.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!