5 bromo 4 chloro 3 indolyl phosphate bcip

For further verification of the functionality of the GfED, protein extracts from lysed bacterial cells (10⁸ CFU/ml) or 0.1 g leaf tissues of C. quinoa were subjected to western blot or far-western blot analysis. Protein samples were analyzed by 12.5% polyacrylamide gel electrophoresis containing 1% sodium dodecyl sulfate (SDS-PAGE) [29 (link)] or no SDS (native-PAGE). Samples were then transferred [30 (link)] from acrylamide gel to PVDF membrane (BioTrace™ PVDF Transfer Membrane, Pall Corporation) and reacted with primary antibodies and a secondary antibody (anti-Rabbit or -Mouse IgG-Alkaline phosphatase antibodies, Sigma Aldrich). The primary antibodies used in this study include those specific to sGFP (anti-GFP) [31 (link)], BaMV CP (anti-BaMV CP) [31 (link)], bacterial cells or lipo-polysaccharides of Ac (anti-Ac, mAb-29, respectively, Kuo et al. unpublished), and the C4 protein of Ageratum yellow vein virus (anti-AYVVC4, Hu et al. unpublished). All of the antibodies were used at a 10000X dilution. For color development, staining solution containing 0.33 mg/ml Nitro blue tetrazolium (NBT), 0.165 mg/ml 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, Promega), 100 mM Tris-HCl, pH 9.5, 150 mM NaCl, and 1 mM MgCl₂ was applied on membrane for 5–10 min. The staining was terminated by washing with H₂O.

The cRNA probe against IGHG1 was prepared as described previously1 (link). And the probe sequences were validated with DNA sequencing. Briefly, deparaffinized and dehydrated human spleen tissue sections (4 μm) were incubated in 0.1 M HCl for 10 min, and heated to 95 °C in a microwave oven in 0.01 M citrate buffer (pH 6.0) for 20 min. The slides were cooled to room temperature, washed with PBS, fixed in 4% PFA for 10 min, and hybridized overnight at 55 °C with human IGHG1 cRNA probe (sequence: acggcgtggaggtgcataatgccaagacaaagccgcgggaggagca gtacaacagcacgtaccgtg tggtcagcgtcctcaccgtcctgcaccaggactggctgaatggcaaggagtacaagtgcaaggtctccaacaaagccctcccagcccccatcgagaaaaccatctccaaagccaaagggcagccccgagaaccacaggtgtacaccctgcccccatcccgggaggagatgaccaagaaccaggtcagcctgacctgcctggtcaaaggcttctatcccagcgacatcgccgtggagtgggagagcaatgggcagccggagaacaactacaagaccacgcctccc). After hybridization, sections were washed in 2 × SSC plus 50% formamide for 15 min and 2 × SSC twice for 15 min (50 °C) each. The samples were incubated with anti-digoxigenin antibody conjugated with alkaline phosphatase (AP) (dilution 1:500; Roche Diagnostics, Switzerland). 5-Bromo-4-chloro-3-in-dolyl phosphate (BCIP) and nitro-blue-tetrazolium (NBT) (Promega, USA) were used for the color reaction. For controls, slides were incubated with the corresponding sense probes. Finally, all sections were counterstained with methyl green.

Non-irradiated or irradiated cultures (5 kGy) of D radiodurans producing the DdrD-HA protein were diluted in 120 mL TGY2X broth to an A_{650 nm} = 0.2 and incubated at 30 °C with shaking. Aliquots of 15 mL were taken at different times and centrifuged. The cell pellets were resuspended in 150 µL 1X SSC buffer (150 mM NaCl, 15 mM trisodium citrate, pH 7) and cell extracts were prepared as previously described (de la Tour et al. 2009 (link)). 10 µg of crude extracts were resolved in 12% SDS–PAGE gels and transferred onto a PVDF membrane (GE Healthcare). The membranes were incubated overnight at 4 °C with a 1:5000 dilution of monoclonal mouse anti-HA antibodies (Eurogentec), and then 1 h at room temperature with a secondary alkaline phosphatase-labeled anti-mouse antibody, and revealed by a colorimetric reaction using nitroblue tetrazolium (NBT) and 5-bromo-4-chloro-3-indolyl phosphate (BCIP) as substrates for the alkaline phosphatase (Promega).

The concentrations of purified Cdc13s were estimated by SDS-PAGE and Coomassie staining; defined levels of bovine serum albumin (BSA) were applied to the same gel and their staining intensities used to construct a standard curve for protein concentration determination.
Western analysis was performed according to the ProtoBlot® II alkaline phosphatase (AP) System (Promega Corp.). The nitrocellulose membranes carrying transferred proteins were first incubated with primary antibodies (anti-His₆ [Santa Cruz Biotechnology, Inc.] at 1:1000 dilution; anti-GST [GE Healthcare, Inc.] at 1:1000 dilution or anti-FLAG [Sigma-Aldrich Co.] at 1:5000 dilution) for 1 h, followed by incubation with alkaline phosphatase-conjugated secondary antibodies (anti-rabbit IgG, anti-goat IgG or anti-mouse IgG [Sigma-Aldrich Co.] at 1:5000 dilution) for 30 min. The antibody-bound proteins were visualized in nitro blue tetrazolium (NBT) and 5-bromo-4-chloro-3-indolyl-phosphate (BCIP)-containing buffers according to the manufacturer's instructions (Promega Corp.).

Mouse 3T3-L1 fibroblast cells were used in this study; 3T3-L1 cells were maintained in vitro at 37 °C (5% CO2) in DMEM-HG (Dulbecco’s Modified Eagle’s Medium containing a high concentration (4,500 mg/L) of glucose (D5796; Sigma, St. Louis, MO, USA) supplemented with 75 μg/mL penicillin, 50 μg/mL streptomycin and 10% (v/v) fetal bovine serum (FBS)). DIF-1, DIF-1(3M), and CP-DIF-1 were synthesized as previously described [16 (link)] and stored at –20 °C as 2.5–10 mM solutions in dimethylsulfoxide (DMSO). DNP, 5-aminoimidazole-4-carboxamide-1-β-d-ribofuranoside (AICAR), and 6-[4-(2-Piperidin-1-ylethoxy) phenyl]-3-pyridin-4-ylpyrazolo [1,5-a] pyrimidine (compound C) were obtained from Wako Pure Chemical Industries (Osaka, Japan). DNP were dissolved in ethanol (EtOH) and compound C in DMSO. Rabbit antibodies against AMPKα, phospho-AMPKα, AMPKβ, phospho-AMPKβ, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were purchased from Cell Signaling Technology (Beverly, MA, USA). Alkaline phosphatase-conjugated goat anti-rabbit IgG antibody, nitroblue tetrazolium (NBT), and 5-bromo-4-chloro-3′-indolylphosphate (BCIP) were purchased from Promega (Madison, WI, USA). The small interfering RNA (siRNA) for AMPKα1/2 (sc-45313) was obtained from Santa Cruz Biotechnology Inc. (Dallas, TX, USA).

Eggs from female ticks treated with dsRNA or PBS injection were collected 9 days after oviposition (10 eggs from each group) and homogenized in 10 mM Tris-HCl buffer, pH 7.4, containing a protease inhibitor cocktail (4EBSF, aprotinin, bestatin hydrochloride, E-64, EDTA, leupeptin hemisulfate salt), pepstatin A (1 mM), and Triton X-100 10%. The samples were kept on ice and immediately used for determination of vitellin content by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and dot blot.
SDS-PAGE was performed under denaturing conditions following the method of Laemmli (1970) (link), followed of silver staining. For dot blot, each sample was spotted onto nitrocellulose membrane (5 μL per spot) and allowed to dry. The membranes were processed as follows: 1 h at room temperature with blocking solution (5% non-fat dry milk/PBS); overnight at 4°C with anti-Vt rabbit serum (1:1000 in blocking solution) (Canal et al., 1995 (link)), or blocking solution only, as control; three times 5-min washes with PBS; 1 h at room temperature with secondary antibody (anti-IgG alkaline phosphatase conjugate 1:5000 in blocking solution). Alkaline phosphatase detection was performed with nitro blue tetrazolium (NBT) and 5-bromo4- chloro-3- indolyl phosphate (BCIP) (Promega, United States) in 100 mM Tris pH 9.5 containing 5 mM MgCl₂ and 100 mM NaCl.

Buffer I (0.1 M Tris-hydrochloride, 0.15 M NaCl, pH 7.5) was used for equilibrating the sections for 5 min. Then the sections were incubated in DIG Buffer I, consisting of 1∶2000 anti-DIG alkaline phosphatase conjugated Fab fragments (Roche, Branford, USA) and 0.5% (w/v) blocking reagent (Roche, Branford, USA) for about 2 h at room temperature. Then the sections were washed three times with Buffer I for 15 min each time and then equilibrated in Buffer II (0.1 M Tris-HCl, 0.1 M NaCl, 0.05 M MgCl2, pH 9.5) for 15 min at room temperature. The chromogenic agent (330 µg/mL nitroblue tetrazolium chloride and (NBT) and 165 µg/mL 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) in Buffer II) (Promega, Beijing, China) were used to color the sections in the dark for 2 h at room temperature. The final reaction ceased through rinsing the sections in 1×TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0). The nonspecific stain was removed in 95% ethanol for 1.5 h. Deionized water was used to wash the precipitated Tris crystals for 15 min. A series of ethanol at 50, 75, 95, 100% level were used to dehydrate the sections. The sections were infiltrated in xylol and mounted. A Nikon Eclipse E80i microscope (Nikon, Tokyo, Japan) was used to observe the signals.