The largest database of trusted experimental protocols

7 protocols using anti foxp1

1

ChIP Assay for FOXP1 Binding on CASC21 Promoter

Check if the same lab product or an alternative is used in the 5 most similar protocols
The ChIP assay was performed using the ChIP Assay Kit (Millipore, USA) following the manufacturer’s instructions. Briefly, 1x107 of CRC cells were collected and cross-linked with 1% formaldehyde solution for 20 min. DNA fragments ranging from 200 to 500 bp were obtained by ultrasonication. Then the lysate was immunoprecipitated with anti-FOXP1 (#4402, Cell Signaling Technology, USA), or IgG antibodies. ChIP primer for the CASC21 promoter: GTGAGATGGTGAGGTGTGGA (forward) and CCCTTTGGCTCAAGGAACAC (reverse).
+ Open protocol
+ Expand
2

Protein Extraction and Western Blot Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
After being treated and cultured, the cells were harvested and protein extractions were prepared with a modified RIPA buffer (Beyotime Institute of Biotechnology) with 0.5% SDS in the presence of a proteinase inhibitor cocktail (Beyotime Institute of Biotechnology). A bicinchoninic acid protein concentration kit (cat. no. P0011; Beyotime Institute of Biotechnology) was used to determine protein concentration. A total of 20 µg protein/lane was separated by 6% or 12% SDS-PAGE. Proteins were then transferred onto a PVDF membrane. The membranes were then blocked with 5% BSA containing TBS-0.05% Tween-20 for ~2 h at room temperature and incubated overnight at 4˚C with the following primary antibodies: Anti-C-MYC (1:1,000; cat. no. ab32072; Abcam), anti-Foxp1 (1:1,000; cat. no. 4402; Cell Signaling Technology, Inc.) and GAPDH (1:1,000; cat. no. ab8245; Abcam). After washing with PBS containing 0.1% Tween-20 three times for 5 min each, the membranes were incubated with horseradish peroxidase-linked immunoglobulin G (1:1,000; cat. no. 7074; Cell Signaling Technology, Inc.) secondary antibody for 2 h at room temperature. The membranes were developed using an enhanced chemiluminescence system (Guangzhou Forevergreen Biosciences Co., Ltd.).
+ Open protocol
+ Expand
3

Western Blot Analysis of FOXP1 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were lysed directly in the plate with Laemmli buffer (0.12 mol/L Tris-HCl [pH 6.8], 4% SDS, and 20% glycerol). Protein concentration was measured with the Lowry assay. Each sample (40 μg) was analyzed by SDS-PAGE and transferred by electrophoresis onto polyvinylidene difluoride membrane (Millipore, Bedford, MA). The membranes were blocked using 2% BSA in TBST (0.3% Tween, 10 mM Tris [pH 8], and 150 mM NaCl in H2O) and probed with anti-FOXP1 (Cell Signaling Technologies, Danvers, MA, no. 2005, 1:1,000) and anti-Tubulin (Sigma-Aldrich, St. Louis, MO; T5168, 1:50,000). Signal was detected using Amersham ECL Western Blotting Detection Reagent (Little Chalfont, UK).
+ Open protocol
+ Expand
4

Quantification of Protein Levels in Infected Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Infected cells were harvested and lysed in lysis buffer (#9803, Cell Signaling Technology, Danvers, MA, USA) supplemented with protease inhibitor. After centrifugation at 14,000 rpm for 10 min (4 °C), supernatants were collected, and protein concentrations were measured using the bicinchoninic acid (BCA) Protein Assay Kit (Thermo Fisher Scientific Inc., Waltham, MA, USA) according to the manufacturer’s protocol. Then, 20 µg of protein was separated on a polyacrylamide gel and transferred to a nitrocellulose membrane followed by incubation overnight at 4 °C with primary antibodies, anti-Ago2 (2E12-1C9, Abnova, Taipei, Taiwan), anti-MNT (#A303-626A, Bethyl Lab, Montgomery, TX, USA), anti-IRAK4 (ab32511, Cambridge, UK), and anti-FOXP1 (#2005, Cell Signaling Technology, Danvers, MA, USA)). All antibodies were diluted 1000× in 5% milk in Tris-buffered saline with Tween-20 (TBST). After incubation with the secondary and tertiary (for MNT, IRAK4, and FOXP1) antibodies and with the enhanced chemiluminescence (ECL) substrate (Thermo Fisher Scientific Inc.), chemiluminescence was detected. Ago2 was quantified with Image Lab 4.0.1 software (BioRad, Hercules, CA, USA), and MNT, IRAK4, and FOXP1 were quantified using ImageJ (NIH, Bethesda, MD, USA). MNT, IRAK4, and FOXP1 protein levels were normalized relative to the total protein amount in the complete lane.
+ Open protocol
+ Expand
5

Protein Expression Analysis by Immunoblotting

Check if the same lab product or an alternative is used in the 5 most similar protocols
Immunoblotting and immunoprecipitation were performed according to standard protocol with the following antibodies: anti-TET2 (#36449, Cell Signaling Technology; #61389, Active Motif, 1:1000), anti-β-Actin (#A5316, Sigma, 1:5000), anti-β-Casein (#sc166530, Santa Cruz, 1:1000), anti-ERα (#ab32063, Abcam, 1:1000), anti-GATA3 (#PA520892, Thermo Fisher Scientific, 1:1000), anti-FOXA1 (sc101058, Santa Cruz, 1:1000), and anti-FOXP1 (#4402T, Cell Signaling Technologies, 1:1000). HRP-conjugated secondary antibody (#610-103-121 and #610-103-122, Rockland Immunochemicals, 1:5000).
+ Open protocol
+ Expand
6

Protein Expression Analysis by Western Blot

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cellular proteins were separated by SDS-polyacrylamide gel electrophoresis (4% stacking and 10% separating gels) and then transferred onto polyvinylidene fluoride membranes (Millipore, USA). The membranes were blocked with 5% skim milk for 1 h and then incubated with primary antibodies (anti-FOXP1 (#4402, Cell Signaling Technology, USA), anti-Cyclin D1(#55506, Cell Signaling Technology, USA), anti-Cyclin D2(#3741, Cell Signaling Technology, USA) anti- CDK6 (#13331, Cell Signaling Technology, USA) and anti-GAPDH(#5174, Cell Signaling Technology, USA)) overnight at 4 °C. After the membranes were incubated with secondary antibodies, they were subjected to immunoblot analysis using an ECL immunoblotting kit according to the manufacturer’s protocol.
+ Open protocol
+ Expand
7

Western Blotting of Cell Lysates

Check if the same lab product or an alternative is used in the 5 most similar protocols
Western blotting was performed as described previously (Li et al., 2011) . Briefly, the cells was lysed in RIPA buffer [50mM Tris (pH 7.4), 150mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, with the addition of Protease Inhibitor Cocktail (Roche)]. The proteins samples were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE, 10% acrylamide resolving gels). The Antibodies used in this study were as follows: anti-GAPDH, anti-FoxP1 and anti-PDGFRa were obtained from Cell Signaling Technology, and the anti-Mouse/-Rabbit Secondary Antibodies were purchased from Santa Cruz Biotechnology.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!