Dnase rnase free distilled water

N2, CZ1200, dnj-14 (ok237) and dnj-14 (tm3223) strains were first age synchronised by bleaching. Worms were then grown for 2 days after L4 stage (day 2 of adulthood) and 50 hermaphrodites of each strain were transferred to new plates and allowed to lay eggs for 6 hours before removal. After hatching worms were grown until L4 stage then 400 hermaphrodites from each strain were picked onto fresh plates. Worms were transferred onto fresh plates on alternate days until day 6 of adulthood when worms were harvested by washing plates with DNase/RNase-free distilled water (Invitrogen). Total RNA was extracted using TRIzol reagent (Invitrogen) and purified using Qiagen RNAeasy Mini Kit (Qiagen). Three biological replicates were prepared for each of the four strains used and hybridised to Affymetrix C. elegans GeneChip arrays according to the manufacturer’s instructions.

All materials except otherwise stated were purchased from Sigma-Aldrich. Dulbecco’s modified eagle medium (DMEM) high glucose with L-glutamine was purchased from Lonza. Fetal bovine serum (FBS), Trypsin-EDTA (0.05%), and penicillin-streptomycin (10,000 U/ml) and DNase/RNase-free distilled water and TRIzol® reagent were purchased from Invitrogen.

All collected organs were stored in Eppendorf tubes at 4°C for one day. One piece of each organ was then transferred to another 1.5 mL-Eppendorf tube containing 500 μL of sterile PBS. The organs were vigorously crushed using a single use sterile piston and 200 μL of organ juice were put into a 1.5 mL-Eppendorf tube containing a mixture of 200 μL G2 lysis buffer, 20 μL proteinase K and a small quantity of glass powder. The tube underwent three cycles of FastPrep 24^TM-5 (MP Biomedicals, Strasbourg, France) before being heated to 56°C for two hours. 200 μL of supernatant was then used to extract DNA using the EZ1 apparatus according to the manufacturer’s recommendations (Qiagen, GmbH, Germany). Extracted DNA was stored at 4°C. Detection of M. ulcerans DNA was performed by using real-time PCR (RT-PCR) and a CFX thermal cycler (BIO-Rad, Marnes-la-Coquette, France) using specific primers targeting the ketoreductase B gene (KR-b) and the IS2404 and IS2606 insertion sequences, as previously described [14 (link)]. The negative controls of our RT-PCR reactions were formed from the same reaction mix as our samples, switching only the 5μL of DNA for 5 μL of ultrapure™ DNase/RNase-Free Distilled Water (Invitrogen France). One negative control was placed after every five samples on a Light Cycler 480 multiwell plates 96-well plate (Roche).

For Slide-tags multiomic snATAC-seq and snRNA-seq experiments, 43.3 µl of counted nuclei was loaded into the 10x Genomics Chromium controller using the Chromium Next GEM Single Cell Multiome ATAC + Gene Expression Reagent Bundle (10x Genomics, PN-1000283). The Chromium Next GEM Single Cell Multiome ATAC + Gene Expression CG000338 Rev F user guide was used according to the manufacturer’s recommendations with slight modifications. During step 4.1, 1 μl of 0.329 μM spike-in primer (5′-GTGACTGGAGTTCAGACGT-3′) was added. For spatial barcode libraries, a custom PCR protocol was used: 5 μl of cleaned supernatant from step 4.3, 50 µl NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541S), 2.5 µl 10 μM STAG_iP7_a1 oligo (5′-CAAGCAGAAGACGGCATACGAGATATTTACCGCAGTGACTGGAGTTCAGACGT*G*T-3′), 2.5 µl 10 μM P5-STAG_ip5_a1 oligo (5′-AATGATACGGCGACCACCGAGATCTACACGACAATAAAGACACTCTTTCCCTACACGACGC*T*C-3′), 40 µl ultrapure DNase/RNase-free distilled water (Invitrogen, 10977015). In this sample, 15 PCR cycles were performed according to the protocol used in the Chromium Next GEM Single Cell 3′ Reagent Kits v3.1 (Dual Index) with Feature Barcode technology for Cell Surface Protein CG000317 Rev C user guide step 4.1.