Sequence analysis software

The cloning and the sequence analysis of both the human MCM (Ledley et al., 1988 (link)); (Jansen et al., 1989 (link)) and the MCM from Propionibacterium shermanii (Marsh et al., 1989 (link)) have revealed the very high amino acid sequence homology (65% identity) between the mature human enzyme and the α-subunit of the P. shermanii enzyme. This allowed the construction of a 3D model that satisfies spatial constraints (Thomä and Leadlay, 1996 (link)). The human MCM differs in being α homodimer rather than α, β heterodimers, and it binds 2 adenosylcobalamin molecules per dimer rather than 1. To construct the three-dimensional structure of human MCM, files were processed using sequence analysis software (PE Applied Biosystems) and were assembled and analyzed using the Phred/Phrap/Consed System (Ewing et al., 1998 (link)), (Gordon et al., 1998 (link)). Molecular modeling simulations were performed with the Modeller 9.11 software (Šali and Blundell, n.d. ). The input to the program is an alignment of the target sequence with the related three dimensional structures (α chain of the P. shermanii enzyme (PDB: 1REQ) and human MCM enzyme (PDB: 3BIC and 2XIQ3BIC2XIQ)).

Sanger sequencing was performed on two areas of tumour for two cases (cases 2 and 4) using 100 ng of genomic DNA with 0.2 mm of each primer, 0.5 U Platinum TAQ, ×10 PCR Buffer (Invitrogen, Burlington, Ontario, Canada) and 400 mm each dNTP. Cycling conditions were denaturation at 94 °C for 1 min, followed by 35 cycles of 30 s at 95 °C, 30 s at 55 °C and 1 min at 72 °C, with final elongation at 72 °C for 5 min. Sanger sequencing was performed using the BigDye Terminator v1.1 Cycle Sequencing Kit (ThermoFischer Scientific) and analysed using Sequence Analysis Software (Applied Biosystems). Primers used to confirm the MSH6 variant were forward (5′‐AGCCTCACTTTTACCCTCTCTTTT‐3′) and reverse (5′‐ACTGGCTGACTTTTATGTAACTGTG‐3′). Areas of tumour with heterogeneous MMR IHC staining were separately macrodissected, so both IHC‐positive tumour and IHC‐negative tumour areas underwent Sanger sequencing performed. Sanger sequencing was performed on the gastric invasive tumour and on the gastric dysplastic non‐invasive component from case 5.