Total RNA was isolated from cultured glial cells using Trizol Reagent (Thermo Fisher Scientific) according to the manufacturer’s instructions and quantified using a Nanodrop ND-1000 spectrophotometer. Prior to reverse transcription, RNA was treated with amplification grade DNase (Sigma Aldrich) to remove genomic DNA. All RNA samples were diluted to the same concentration and reverse transcribed in the presence of random hexamers using 200 U of RNase H minus Moloney leukemia virus reverse transcriptase (Promega, Madison, WI) in the buffer supplied by the manufacturer. Semi-quantitative RT-PCR was performed on 5% of the reverse-transcribed cDNA product to assess the relative levels of expression of mRNA-encoding IFN-β and the housekeeping gene product glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Positive and negative strand PCR primers used, respectively, were GACGCCGCATTGACCATCTA and CCTTAGGATTTCCACTCTGACT to amplify mRNA encoding IFN-β, and CCATCACCATCTTCCAGGAGCGAG and CACAGTCTTCTGGGTGGCAGTGAT to amplify mRNA encoding GAPDH.
Amplification grade dnase
Manufactured by Merck Group
Sourced in United States
Amplification grade DNase is a laboratory reagent designed to degrade DNA. It is used to remove DNA contamination from samples prior to RNA analysis or other applications where the presence of DNA could interfere with the desired outcome.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Rnase h minus moloney leukemia virus reverse transcriptase, by Promega (2 mentions)
Stop solution, by Merck Group (1 mentions)
Mastercycler realplex, by Eppendorf (1 mentions)
Beclin sirna, by Horizon Discovery (1 mentions)
Dnase, by Merck Group (1 mentions)
Superscript 3 first strand synthesis supermix, by Thermo Fisher Scientific (1 mentions)
4 protocols using amplification grade dnase
1
Quantifying Interferon-Beta Expression in Glial Cells
2
Beclin-1 Silencing Impacts Total RNA Isolation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated by Trizol reagent from DCs incubated with beclin siRNA according to the manufacturer’s instructions (Dharmacon, Chicago, IL, USA). RNA was quantified with the help of NanoDrop. A260/A280 ratio of all samples was in the range of 1.90–2.00. Intactness of RNA samples was determined with the help of formaldehyde denaturing agarose gel-electrophoresis. DNA contamination from RNA samples was removed by amplification grade DNase (Sigma, St Louis, MO, USA). Briefly, RNA samples (1 μg) were incubated with DNase (1U) for 15 min in the reaction buffer. After the incubation, DNase activity was terminated by stop solution (Sigma, St Louis, MO, USA). Furthermore, the samples were heated to 70°C for 10 min to inactivate DNase activity. Results are represented in the form of re-expression (fold) relative to untreated controls. Analysis was done by comparative Ct method, whereas Ct values were normalized against house-keeping control actin. RT-qPCR and data analysis were done by Realplex Mastercycler (Eppendorf, Hamburg, Germany).
3
Transcriptional Analysis of Ac4p3 and CvA in Bivalve Species
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from A. colbecki and C. islandica gonad and muscle (tissues collected from species of interest during the sampling) with TRIzol reagent (Invitrogen, Carlsbad, CA) and treated with amplification grade DNase according to the manufacturer’s instructions (Sigma-Aldrich, Darmstadt, DE). The cDNA was obtained using SuperScript III First-Strand Synthesis SuperMix (Invitrogen, Carlsbad, CA). The transcriptional activity of Ac4p3 in A. colbecki and C. islandica was detected using the above degenerate primer pair under the following conditions: 2 min at 94°C; 30 cycles at 94°C for 1 min, 48°C for 1 min, and 72°C for 1 min; and 10 min at 72°C. The transcriptional activity of the CvA element in A. colbecki was tested using the above primer pair under the same conditions.
4
Glial Cell NK-1R Expression Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cultured glial cells using Trizol Reagent (Thermo Fisher Scientific) according to the manufacturer’s instructions and quantified using a Nanodrop ND-1000 spectrophotometer. Prior to reverse transcription, RNA was treated with amplification grade DNase (Sigma-Aldrich) to remove genomic DNA. All RNA samples were diluted to the same concentration and reverse transcribed in the presence of random hexamers using 200 U of RNase H minus Moloney leukemia virus reverse transcriptase (Promega, Madison, WI) in the buffer supplied by the manufacturer. Semi-quantitative RT-PCR was performed on 5% of the reverse-transcribed cDNA product to assess the relative levels of expression of mRNA encoding NK-1R and the housekeeping gene product glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Positive and negative strand PCR primers used, respectively, were AACCCAAGTTCGAACCAG and ATGTACCTATCAAAGGCCACAGCC to amplify mRNA encoding total NK-1R, TCTTCTTCCTCCTGCCCTACATC and AGCACCGGAAGGCATGCTTGAAGCCCA to amplify mRNA encoding full-length NK-1R, ATCCTGGTGGCGTTGGCAGTC and GAGAGATCTGGCCATGTCCATAAAGA to amplify mRNA encoding preprotachykinin (PPT), and CCATCACCATCTTCCAGGAGCGAG and CACAGTCTTCTGGGTGGCAGTGAT to amplify mRNA encoding GAPDH.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!