ThermoScientific CRISPR794433_CR guide RNA (gRNA), which targets the DNA sequence (GGCTCCGGTTAAGGTAGAGG) on the reverse strand of RET gene, was used to generate RET KO from the parental SK-N-AS cell line (ECACC 94092302, Merck, Darmstadt, Germany). Transfection was performed with Lipofectamine CRISPRMAX Cas9 transfection reagents (ThermoScientific, Waltham, MA, USA) according to the manufacturer’s protocol. Forty-eight hours after transfection, cells were harvested for Western blot analysis to confirm the KO efficiency. Parallel cell samples were harvested and serially diluted to 8–10 cells/mL. The resulting cell suspension was subsequently seeded into 96-well plates at 100 μL per well. The resulting single-cell clones were expanded and subjected to Western blot analysis to confirm loss of RET protein. Five RET KO clones and one clone with higher RET expression level were chosen, and, together with parental cells, they were subjected to RNAseq analysis (Novogene, Cambridge, UK) and Cell Line Authentication test (Eurofins Genomics, Ebersberg, Germany).
Cell line authentication test
Manufactured by Eurofins
Sourced in United Kingdom
The Cell Line Authentication test is a laboratory service provided by Eurofins that verifies the identity of cell lines used in research and development. The test utilizes DNA profiling techniques to compare the genetic profile of a cell line sample to a reference profile, confirming the sample's identity.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine crisprmax cas9 transfection reagent, by Thermo Fisher Scientific (1 mentions)
Rna seq analysis, by Novogene (1 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (1 mentions)
Gentamicin amphotericin, by Thermo Fisher Scientific (1 mentions)
Epilife medium, by Thermo Fisher Scientific (1 mentions)
2 protocols using cell line authentication test
1
RET Gene Knockout in SK-N-AS Cells
2
Cell Culture Conditions for Diverse Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HeLa, 293T, SiHa and C33A cells were cultured in Dulbecco's modified Eagle’s medium (DMEM; Cytiva, previously Hyclone) supplemented with 10% bovine calf serum (BCS; Hyclone) and 1% penicillin–streptomycin (Gibco). The normal neonatal human foreskin primary keratinocytes [nHFKs (HEKn, PCS-200–010)] were purchased from ATCC and grown in EpiLife medium (Gibco) with 1% human keratinocyte growth supplements (HKGS, Gibco) and 0.2% gentamicin/amphotericin (Gibco). This medium was also used for propagation of the immortalized human keratinocyte cell line JJM9721 established here by stable transfection of HFKs with pC97ELsL. The HeLa, SiHa and JJM9721 cell lines used here have been subjected to the Cell Line Authentication Test (Eurofins Genomics).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!