Forward and reverse primers

RNAs were extracted using RNeasy Mini Kit (Qiagen) and were frozen at −80°C. We used Nano‐Drop 2000c (Thermo) to evaluate the quality and quantity of isolated total RNAs. In this regard, RNA samples with A260/A280 ratios of >1.8 were selected for quantitative analysis. First‐strand complementary DNA (cDNA) synthesis was initially performed using the Revert Aid First Strand cDNA Synthesis Kit (Thermo Scientific, Fermentas). Then, real‐time quantification was performed using Rotor gene‐Q real‐time PCR system (Qiagen). Each real‐time PCR (10 μL) included 1 μL of reverse and forward primers (Exiqon), 5 μL of Ampliqon real Q plus 2× master mix green (Ampliqon), and 4 μL of diluted cDNA. Primer sequences for the ACE‐2 gene were F: 5′‐TCCATTGGTCTTCTGTCACCCG‐3′, R: 5′‐AGACCATCCACCTCCACTTCTC‐3′. The reactions were incubated in a 72‐well optical strip at 95°C for 15 min (enzyme activation), followed by 95°C for 20 s and 60°C for 60 s (40 cycles). All reactions were run in triplicate. After the reactions, the mean Ct was determined from the triplicate PCRs. We used Ct values to evaluate the expression levels of the ACE‐2 gene. It should be noted that Beta‐actin was the endogenous control gene to normalize RNA contents among different samples. The expression value of the ACE‐2 gene relative to internal controls was determined using the 2^−ΔCt method.

After liqufication, we centrifuged the semen samples for 10 min at 500 g. Then 1 ml FSB (Merck, Germany) was added to sperms pellet and somatic cells removed.TRIZOL reagent was used for isolation of the total RNA from the sperms based on kit protocols (Invitrogen Life Technology Co., USA). hsa-miR-449-a (MI0001648), hsa-miR-449-b (MI0003673), and hsa-449-c (MI0003823) were studied in this research. hsa-miR30a-5p (MIMAT0000087) and hsa-miR100-5p (MIMAT 0000102) were used as internal controls. Rotor gene-Q real-time PCR system (Qiagene, Germany) was used to quantifing of the RNA expression. Total amount of master mix was 10 µl and included 1 µl of reverse and forward primers (Exiqon, Denmark), 5 µl of Ampliqon real Q plus 2 $\times$ master mix green (Ampliqone, Denmark), and 4 µl of diluted cDNA. For enzyme activation we incubated master mix for 15 min at 95°C. Then reaction was runned in 40 cycle for 20 sec at 95°C and 60 sec at 60°C. Ct values was used for evaluation of expression rate of studied miRNAs. hsa-miR30a-5p and hsa-miR100-5p were used as the endogenous controls. The 2 ${}^{-▵\mathrm{Ct}}$ method used for expression rate detection of target genes in comparision to internal controls.

For total DNA isolation, strains were cultivated in TSB medium for 3 days at 28 °C and shaken at 180 rpm. Total DNA was isolated by the salting-out procedure, as described in [13 ]. Amplification of the 16S rRNA gene was carried out using the primers 8F (5′-AGAGTTTGATYMTGGCTCAG-3′) and 1510R (5′-TACGGYTACCTTGTTACGACTT-3′). A polymerase chain reaction (PCR) was carried out in a total volume of 50 μL containing 2.0 μL of genomic DNA (~50 ng), 0.5 μL of each primer (100 pmol), 1.0 μL of deoxynucleotide triphosphates (10.0 mM each), 5.0 μL of 10 × PCR buffer, 0.5 μL of DNA polymerase (1 U/μL), 2.5 μL dimethyl sulfoxide and 38.0 μL of Milli-Q grade water. The PCR parameters were initial denaturation at 95 °C for 5 min, followed by 30 cycles of denaturation at 95 °C for 30 s, annealing for primers at 53 °C for 30 s and extension at 72 °C for 90 s. A final extension was carried out at 72 °C for 10 min. The received PCR products were visualized in 1% agarose gel and then purified using the QIAquick Gel Extraction Kit (Qiagen, Venlo, Netherlands) and sequenced with forward and reverse primers by Explogen LLC (Lviv, Ukraine). The 16S rRNA gene sequence of Streptomyces sp. Pv 4-95 was deposited in GenBank with the accession number OM763959.