Abi 7500 real time pcr instrument

TRIZOL reagent was used to extract total RNA, and the cDNA Synthesis Kit from Yeasen Biotech was used to synthesize first-strand cDNA, following the manufacturer's instructions. RT-PCR was performed using the SYBR FAST qPCR Kit Master Mix (2×) Universal (Kapa Biosystems) on the ABI 7500 Real-time PCR Instrument (Life Technologies, CA, USA) in a 20 μl system. In addition, the SYBR FAST qPCR Kit Master Mix (2×) Universal (Kapa Biosystems) was utilized to perform RT-PCR on the ABI 7500 Real-time PCR Instrument (Life Technologies, CA, USA) in a 20 μl system. A total of 6 control samples and 8 UPJ samples were employed for RT-PCR. The following PCR primers were used: PAR1fw: 5′- TGCCTACTTTGCCTACCTCC -3′, PAR1rv: 5′- GTAGACGTACCTCTGGCAC -3′, PAR2fw: 5′- GCGATCTTCTGCCATGGATG -3′, PAR2rv: 5′- AGATCAGGTACATGGCCAGG -3′, GAPDHfw: 5′- GGAGTCAACGGATTTGGT -3′, GAPDHrv: 5′- GTGATGGGATTTCCATTGAT -3′. The relative changes in the expression levels of PAR1 and PAR2 were normalized against the levels of GAPDH gene expression in each sample using the ΔΔCt method. Each sample and primer were subjected to triplicate experiments. Furthermore, the relative mRNA expression levels of PAR1 and PAR2 in different Onen grades of preoperative hydronephrosis were investigated to explore their clinical implications.

Total RNA was isolated from the cells using Trizol reagent (Invitrogen, USA). Purity and concentration of total RNA were measured by a Nanodrop 1000 spectrophotometer (Thermo Scientific, Rockford, IL). Reverse transcription was performed by FastKing gDNA Dispelling RT SuperMix with RNase Inhibitor (TIANGEN, Beijing). Specific forward and reverse primers (see Supplementary Materials) for each gene were constructed by BioTNT Company. Then, mRNA expression was detected using SuperReal PreMix Plus Kit (Tiangen, Beijing). Reaction was performed in a 96-well plate format using an ABI™7500 real-time PCR instrument (Applied Biosystems). Ct values were converted to comparative Ct values (2^−ΔΔCt) by comparison to reference gene GAPDH.

Total RNA was extracted from 200 μl serum using the miRNeasy Serum/Plasma Kit (Qiagen, Germany) by strictly following the manufacturer's protocol. Synthesis of complementary DNA (cDNA) was performed using TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems, USA) under the following cycling conditions: 16°C for 30 min, 42°C for 30 min, and 85°C for 5 min. Synthesized cDNA was amplified on the ABI7500 Real-Time PCR Instrument (Applied Biosystems, USA) using Taqman PCR master mixture and target-specific TaqMan microRNA assay. The qPCR reaction was carried out according to the following cycling conditions: 95°C for 10 min followed by 40 cycles at 95°C for 15 s and 60°C for 1 min. The expression level of miRNA-29b was presented by relative fold change to U6 RNA based on the CT method. The RT primer, PCR primers, and TaqMan probe for miR-29b-3p were purchased from ABI. The serum level of sclerostin was determined by enzyme-linked immunosorbent assay (ELISA) using a commercially available kit (R&D Systems, USA) as per the manufacturer's protocol. The results were obtained from independent experiments in triplicate.