Primestar dna polymerase

Manufactured by Takara Bio

Sourced in Japan, China, United States

PrimeSTAR DNA polymerase is a high-fidelity DNA polymerase suitable for PCR amplification. It has a proofreading function and produces blunt-ended PCR products.

Automatically generated - may contain errors

Lab products found in correlation

T4 dna ligase, by Takara Bio (8 mentions) Trizol reagent, by Thermo Fisher Scientific (6 mentions) Restriction enzyme, by Thermo Fisher Scientific (5 mentions) Sapphireamp fast pcr master mix, by Takara Bio (4 mentions) In fusion hd cloning kit, by Takara Bio (4 mentions) Ampicillin, by Sangon (3 mentions) Taq dna polymerase, by Thermo Fisher Scientific (3 mentions) Luciferase assay kit, by Promega (2 mentions) Gel extraction kit, by Qiagen (2 mentions) T4 dna ligase, by New England Biolabs (2 mentions) Superscript 3 system, by Thermo Fisher Scientific (2 mentions) Dna extraction kit, by Tiangen Biotech (2 mentions) Hiseq 2500 platform, by Illumina (2 mentions) Restriction endonuclease, by Takara Bio (2 mentions) Lipofectamine ltx, by Thermo Fisher Scientific (2 mentions) Not 1 cloning sites, by Promega (2 mentions) Neb express, by New England Biolabs (2 mentions) Pmal c5x vector, by New England Biolabs (2 mentions) Gibson assembly kit, by New England Biolabs (2 mentions) Phusion high fidelity dna polymerase, by New England Biolabs (2 mentions)

Close spelling variants of this product

TaKaRa PrimeStar GXL DNA Polymerase PrimeSTAR HS DNA polymerase PrimeSTAR Max DNA Polymerase PrimeSTAR HS DNA polymerase and restriction enzymes PrimeSTAR HS DNA Polymerase with the GC Buffer PrimeSTAR® HS DNA Polymerase kit PrimeSTAR GXL DNA Polymerase PrimeStar® high‐fidelity thermostable DNA polymerase reagent kit DNA polymerase of PrimeSTAR HS PrimeSTAR Max DNA polymerase system

111 protocols using primestar dna polymerase

Saccharomyces cerevisiae Plasmid Construction

Check if the same lab product or an alternative is used in the 5 most similar protocols

All plasmids (Supplementary Data 1 - Table 1) were constructed and amplified with E. coli DH5α. The list of used S. cerevisiae strains is available in Supplementary Data 1 - Table 2. DNA polymerase kits were purchased: High-fidelity Phusion from New England Biolabs, PrimeStar DNA polymerase, and SapphireAmp® Fast PCR Master Mix from TaKaRa Bio. All oligonucleotides (Supplementary Data 1 - Table 4) were synthesized at IDT Biotechnology. All other chemicals were purchased from Sigma-Aldrich.
All codon-optimized heterologous genes were synthesized from GenScript and are listed in Supplementary Data 1 - Table 3.

Tartik M., Liu J., Mohedano M.T., Mao J, & Chen Y. (2023). Optimizing yeast for high-level production of kaempferol and quercetin. Microbial Cell Factories, 22, 74.

+ Open protocol

+ Expand

Verification of miRNA-mRNA Interactions

Check if the same lab product or an alternative is used in the 5 most similar protocols

Dual luciferase reporter assays were performed to verify the direct interactions between KCNQ1OT1 and miR-34a and miR-34a and the 3′-UTR of Atg4B mRNA. PCR was conducted using the PrimeSTAR DNA polymerase (Takara, Kusatsu, Japan) to amplify the KCNQ1OT1 cDNA containing the predicted miR-34a binding site and the 3′-UTR of Atg4B cDNA containing the predicted miR-34a binding site. The primers used are presented in Table S2. Then, the PCR products were purified and cloned to the pmirGLO vector. Afterward, we co-transfected the pmirGLO-WT-KCN1 or -Mut-KCN1 with miR-34a mimics or miRNA-NC into colon cancer cells with Lipofectamine 3000. Also, the pmirGLO-WT-Atg4B or -Mut-Atg4B was transfected in a similar way. The luciferase activity was conducted after 48 h of transfection using the luciferase assay kit (Promega Corporation, Fitchburg, WI, USA) and the Promega GloMax 20/20 machine.

Li Y., Li C., Li D., Yang L., Jin J, & Zhang B. (2019). lncRNA KCNQ1OT1 enhances the chemoresistance of oxaliplatin in colon cancer by targeting the miR-34a/ATG4B pathway. OncoTargets and therapy, 12, 2649-2660.

+ Open protocol

+ Expand

Yeast Display of VNAR Library

Check if the same lab product or an alternative is used in the 5 most similar protocols

The reverse transcription reaction was conducted using SuperScript IV Reverse Transcriptase and oligo (dT)₂₀ primer. A first PCR was performed using primeSTAR DNA polymerase (Takara Bio), first strand cDNA, and VNAR-specific primers. The resultant PCR mixtures were diluted 100-fold with water, and the diluted product was applied to the nested PCR. To create pYES3-VNAR, the Aga2 signal sequence, NheI and BamHI sites, AGIA tag, and Aga2 mature peptide fusion sequence were inserted into the pYES3 vector (Thermo Fisher Scientific). NheI- and BamHI-digested pYES3-VNAR was mixed with purified and nested PCR products, and the mixture was transformed into electrically competent EBY100 yeast (ATCC) (Chao et al., 2006 (link)) using ELEPO21 (Nepa Gene). Four transformations and the dilution plates demonstrated that 1.5 × 10⁷ total transformants were generated for the VNAR library. The yeast was cultured according to previous reports (Chao et al., 2006 (link)).

Takeda H., Ozawa T., Zenke H., Ohnuki Y., Umeda Y., Zhou W., Tomoda H., Takechi A., Narita K., Shimizu T., Miyakawa T., Ito Y, & Sawasaki T. (2023). VNAR development through antigen immunization of Japanese topeshark (Hemitriakis japanica). Frontiers in Bioengineering and Biotechnology, 11, 1265582.

+ Open protocol

+ Expand

T. urticae Genomic DNA Amplification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA isolated from T. urticae was used as a template, and PCR was carried out with primers (table S3) and PrimeSTAR DNA Polymerase (TaKaRa, R045Q) to obtain the corresponding DNA segments encompassing variable exon clusters, constant exons, and intervening sequences (Fig. 2, B and E, and figs. S7, A and C, and S8A). WT minigene DNAs were cloned into the pEASY-blunt zero cloning vector (TransGen Biotech, CB501-01). The minigene constructs were further cloned behind the metallothionein promoter in the pMT/V5-His B vector.

Hou S., Li G., Xu B., Dong H., Zhang S., Fu Y., Shi J., Li L., Fu J., Shi F., Meng Y, & Jin Y. (2022). Trans-splicing facilitated by RNA pairing greatly expands sDscam isoform diversity but not homophilic binding specificity. Science Advances, 8(27), eabn9458.

+ Open protocol

+ Expand

Standard DNA Manipulation and Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Standard methods for DNA manipulation, preparation, and analysis were employed as described previously (Qazi et al., 2001 (link)). Restriction enzymes and T4 DNA ligase were purchased from New England Biolabs (NEB, China) and used in accordance with the manufacturer's instructions. PCR primers (Table 3) were purchased from (Life technologies, Hong Kong). DNA fragments were isolated from electrophoresis agarose (Lonza, Swiss) using gel extraction kit (Qiagen, German). PCR was performed in an ABI thermal cycler 7900 in 50-μL reaction volumes with PrimeSTAR DNA polymerase (Takara, Japan) in accordance with manufacturer's instructions. E. coli Top10 cells (Life technologies, Hong Kong) were transformed by heat shock operation. S. aureus cells were transformed according to published method (Qazi et al., 2001 (link)).

Gao P., Wang Y., Villanueva I., Ho P.L., Davies J, & Kao R.Y. (2016). Construction of a Multiplex Promoter Reporter Platform to Monitor Staphylococcus aureus Virulence Gene Expression and the Identification of Usnic Acid as a Potent Suppressor of psm Gene Expression. Frontiers in Microbiology, 7, 1344.

+ Open protocol

+ Expand

Constructing Promoter-luxCDABE Reporter Plasmids

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

The pigA promoter on plasmid pMQ713 [56 (link)] was replaced with the SMDB11_1194, SMDB11_1637, and SMDB11_2817 using yeast homologous recombination, as previously described [57 (link),58 (link)]. Plasmids are listed in Table S1. The pMQ713 plasmid was linearized by restriction enzyme digestion with EcoR1 and Sal1 (New England Biolabs, Ipswich, MA, USA). DNA for the three promoter regions were synthesized as linear double-stranded DNA fragments (Integrated DNA Technologies, Coralville, IA, USA) that include DNA for the promoter region and for site-directed recombination with pMQ713 that places the luxCDABE reporter under transcriptional control of the respective promoter (listed in Table S2). The lengths of the cloned promoters were 338 bp for SMDB11_1194, 354 bp for SMDB11_1637, and 337 bp for SMDB11_2817. To generate the nptII-driven luxCDABE plasmid, the tdtomato gene from pMQ414 was digested with BamH1 and EcoR1 enzymes, and the luxCDABE operon was amplified by PCR from pMQ670 [59 (link)] using primers 3805 and 3806 via PrimeSTAR DNA polymerase (Takara Bio, San Jose, CA, USA). The linearized plasmid and luxCDABE amplicon were combined as above. The plasmids were isolated, and the cloned promoter region was sequenced to validate the constructs.

Harshaw N.S., Stella N.A., Lehner K.M., Romanowski E.G., Kowalski R.P, & Shanks R.M. (2021). Antibiotics Used in Empiric Treatment of Ocular Infections Trigger the Bacterial Rcs Stress Response System Independent of Antibiotic Susceptibility. Antibiotics, 10(9), 1033.

+ Open protocol

+ Expand

PCR-based DNA Construct Synthesis and Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Constructs were synthesized using the PCR scheme developed by Zhang and Crothers (32 (link)), as described previously (3 (link)). In short, PCR reactions (50 μl) contained 1× PrimeSTAR buffer, 0.2 mM dNTP mix, 2 μM of each of the primers, 30 nM of the top and bottom templates and 0.04 units of PrimeSTAR DNA polymerase (Takara, Japan). Cyclization kinetics measurements were carried out as described before (3 (link),32 (link)). Ligase concentration was varied as a function of phasing length (0.3 U/μl for the in-phase 156L14 and 156L16 constructs and 1.2 U/μl for all other phasing constructs) and total length (from 0.2 U/μl for the 157 constructs, to 0.8 U/μl for the 154–155 and 158–160 constructs and 2.2 U/μl for the 150–153 constructs). Quantitative data on the conformational properties of the tested DNA molecules was derived by the simulation program developed by Zhang and Crothers (33 (link)), as previously described (3 (link)). The outcome of the simulations are the bend angle, the twist angle, the roll and tilt fluctuations (defined as the thermal fluctuations of the roll and tilt angle between adjacent base pairs, 32 (link),33 (link)), and the twist fluctuations (defined as the thermal fluctuations of the twist angle between adjacent bases, 32 (link),33 (link)), per DNA sequence (p53 half-site).

Senitzki A., Safieh J., Sharma V., Golovenko D., Danin-Poleg Y., Inga A, & Haran T.E. (2021). The complex architecture of p53 binding sites. Nucleic Acids Research, 49(3), 1364-1382.

+ Open protocol

+ Expand

Generation of 6 × myc-OsNAC6 Transgenic Rice

Check if the same lab product or an alternative is used in the 5 most similar protocols

To produce RCc3::6 × myc‐OsNAC6 plants, the coding sequence of OsNAC6 was amplified using PrimeSTAR DNA polymerase (Takara) with the OsNAC6‐B F‐primer (GGATCCATGAGCGGCGGTCAGGACC) and the OsNAC6‐N R‐primer (GCGGCCGCG CTAGAATGGCTTGCCCCAG). After digestion of the PCR products with BamHI and NotI, the coding sequence was ligated into the multiple cloning site of the pE3n vector (Dubin et al., 2008), which is flanked with a 6 × myc tag coding sequence. Finally, the 6 × myc‐OsNAC6 sequence from the pE3n‐OsNAC6 was subcloned into the p700‐RCc3 vector (Jeong et al., 2010) carrying a 1.3‐kb RCc3 promoter sequence, using the Gateway system. Chromatin immunoprecipitation (ChIP) was performed with roots of 2‐week‐old rice seedlings, as described previously (Chung et al., 2009). These data can be found at http://www.ncbi.nlm.nih.gov/geo/ (Accession number: GSE80986).

Lee D., Chung P.J., Jeong J.S., Jang G., Bang S.W., Jung H., Kim Y.S., Ha S., Choi Y.D, & Kim J. (2017). The rice OsNAC6 transcription factor orchestrates multiple molecular mechanisms involving root structural adaptions and nicotianamine biosynthesis for drought tolerance. Plant Biotechnology Journal, 15(6), 754-764.

+ Open protocol

+ Expand

Cloning of Xenopus MBD3 Promoter

Check if the same lab product or an alternative is used in the 5 most similar protocols

The fragment encompassing 1 kb upstream of the 5’-end of the reported Xenopus tropicalis MBD3 cDNA, the exon 1, and part of intron 1 that contained predicted TRE2, was PCR-amplified from genomic DNA with the primer pair of 5’-cctgagctcGCTAGCGGTGATATCACTCCAACTTGC AGC-3’ (Forward, bearing a NheI site at the 5’-end) and 5’-cggattgccAAGCTTgCTCTTTATTCCTCCAGCTGCACC-3’ (Reverse, bearing a HindIII site at the 5’-end) by using high fidelity PrimeStar DNA Polymerase (Takara, Mountain View, CA). The PCR fragment was double-digested with NheI and HindIII, gel-purified, and cloned into pre-digested pGL4.10 firefly luciferase vector (Promega, Madison, WI) bearing the same restriction ends. The mutant promoter harboring a mutated TRE was PCR-amplified from the wild type promoter construct DNA by using the same forward primer for the wild type promoter fragment and 5’-tgccaagcttgCTCTTTATTCCTCCAGCTGCACCCAGTCTGTATGTTTCCATCTGACTCAC-3’ (bearing a HindIII site at the 5’-end with the mutated nucleotides underlined). The PCR fragment was double-digested with NheI and HindIII, gel-purified and cloned into pre-digested pGL4.10 vector bearing the same restriction ends. The mutant construct was confirmed by DNA sequencing.

Fu L., Li C., Na W, & Shi Y.B. (2020). Thyroid hormone activates Xenopus MBD3 gene via an intronic TRE in vivo. Frontiers in bioscience (Landmark edition), 25, 437-451.

+ Open protocol

+ Expand

Optimized DNA Manipulation Techniques

Check if the same lab product or an alternative is used in the 5 most similar protocols

All chemicals were acquired from Sigma‐Aldrich unless otherwise stated. All synthetic DNAs are from Integrated DNA Technologies, and unlabeled DNA oligonucleotides above 100 nt were bought as Ultramers. DreamTaq DNA polymerase (Thermo Scientific) was used for colony PCRs, PCRs for sequencing reactions, preparative PCRs of small fragments (< 200 bp), and emulsion PCR. Phusion DNA polymerase (Thermo Scientific) was used for preparative PCRs. For difficult preparative PCRs, PrimeSTAR DNA polymerase (Takara) was used. For preparative PCRs requiring extra high accuracy, Q5 RNA polymerase was used (NEB). Restriction enzymes, ligases, and other cloning‐related enzymes were procured from Thermo Scientific unless otherwise stated.

Lawson M.J., Camsund D., Larsson J., Baltekin Ö., Fange D, & Elf J. (2017). In situ genotyping of a pooled strain library after characterizing complex phenotypes. Molecular Systems Biology, 13(10), 947.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!