Superscript 3 first strand rt pcr kit

Total RNA was extracted from Arabidopsis leaves using a TRIzol reagent (Invitrogen), and genomic DNA contamination was removed by DNase I (Ambion) treatment. Reverse transcription was conducted with the SuperScript III first-strand RT-PCR kit (Invitrogen), and gene expression was determined using GoTaq qPCR Master Mix (Promega) with transcript-specific primers in a RealPlex S MasterCycler (Eppendorf). Primers used for qRT-PCR are listed in the Supplementary Table 2.

Gene expression analysis was conducted as described previously^{84 (link)}. In brief, leaf tissue from 1-month-old plants was collected at designated time points. At least three leaves derived from three independent plants were collected for each genotype/ treatment/ time point combination. Trizol reagent (Invitrogen) was used to extract total RNA and DNase I (Ambion) was applied to remove DNA contaminants. 10 μg of total RNA were reverse transcribed using SuperScript III first-strand RT-PCR kit (Invitrogen), and quantitative gene expression analysis was determined using GoTaq qPCR Master Mix (Promega) with transcript-specific primers in a RealPlex S MasterCycler (Eppendorf). The Ct values were normalised to ubiquitin 5 (UBQ5) gene. bZIP60 splicing assays were performed as described in Moreno et al.^{33 (link)}. Briefly, we used a common forward primer and a pair of reverse primers that specifically hybridise to either the unspliced or spliced variants of cDNA originated from bZIP60 mRNA, respectively. This allows for the detection of two specific qRT-PCR products corresponding to unspliced and spliced bZIP60 variants (Fig. S5). Primers used for qRT-PCR are listed in Table S1.

RT‐PCR was performed as described previously (Wang et al., 2014). cDNA transcription and PCR were performed using SuperScript III First‐Strand RT‐PCR Kit (Invitrogen). Primers designed by Primer Blast (NCBI Primer BLAST) were used to detect following human genes: OCT4 (forward: 5′‐GGCCACACGTAGGTTCTTGA, reverse: 5′‐CTCCCCACTAGGTTCAGGGA) and HPRT1 (forward: 5′‐GCGTCGTGATTAGCGATGATGAAC, reverse: 5′‐CCTCCCATCTCCTTCATGACATCT). Primers for human NANOG/NANOGP8 were designed to produce a ~ 300‐bp cDNA fragment flanking the nucleotide 144 from the starting codon (forward: 5′‐CCGACTGTAAAGAATCTTCACC, reverse: 5′‐GACAGAAATACCTCAGCCTCC). Sizes of bands were estimated based on expected product length from primer design and DNA ladders (Sigma) on the gel.

The quality of RNA isolated from C. lacryma-jobi was checked on ethidium bromide-stained agarose gels, and RNA concentration was calculated based on the measured optical density of the samples at 260 and 280 nm using a DropSense96C Spectrophotometer (Trinean, Belgium). One microgram of total RNA was used for cDNA synthesis, which was performed using a SuperScript^™ III first strand RT-PCR kit (Invitrogen, USA) with an oligo (dT)₂₀ primer. Quantitative real-time PCR (qRT-PCR) was performed on synthesized cDNA using gene-specific primers (S1 Table). PCR was optimized and performed using the Roche LightCycler 480 II and SYBR Green Real-Time PCR Master Mix (Bio-Rad,Inc., CA). Reaction conditions included an initial denaturation at 95°C for 30 s, 40 cycles of denaturation at 95°C for 10 s, and annealing and extending at 55°C for 15 s. The relative expressions of specific genes were quantified using the 2^-ΔΔCt method [56 (link)].

Leaf tissue was collected from 4-week old Arabidopsis plants that were syringe-infiltrated with 10 µM flg22 (Genscript) or 10 µM elf18 (Genscript).
Pathogen treatments were performed using 4-week old plants that were syringe-infiltration with Psm ES4326/avrRpm1 (OD_600nm = 0.1), spray inoculated with Pst DC3000 (OD_600nm = 0.2, 0.02% Silwet L-77) or Pst DC3118 (OD_600nm = 0.2, 0.02% Silwet L-77). Untreated root, shoot leaf, shoot, and flower tissues were collected to determine the basal levels of tarnscripts. We extracted total RNA from the collected samples using RiboZol (AMRESCO). Possible genomic DNA contamination was eliminated using DNase I (Ambion). Formaldehyde agarose gel preparation, quantification, electrophoresis and samples prepration/loading were done following the RNeasy Plant Mini® Kit QIAGEN protocol. SuperScript III first-strand RT-PCR kit (Invitrogen) was used to convert mRNA into cDNA. We used GoTaq qPCR Master Mix (Promega) to perform qRT-PCR using gene-specific primers in a RealPlex S MasterCycler (Eppendorf). Primers used in this study are listed in the Supplementary Table 1.

Total RNA was extracted from either bone tissues of mice or cultured cells with TRIzol reagent (Invitrogen). cDNAs were synthesized from extracted RNA with the Superscript III First Strand RT–PCR Kit (Invitrogen), and real-time quantitative PCR amplifications were performed in a LightCycler (Roche). β2-microglobulin was used as the internal control to normalize gene expression. For miRNA qRT–PCR, TaqMan MicroRNA Assays (Applied Biosystems) were used to quantify the expression of mature miR-23a (Assay ID: 000399), miR-27a (Assay ID: 000408) and miR-24-2 (Assay ID: 002494). Amplication and detection were performed using the 7500HT Fast Real-Time PCR system (Applied Biosystems) and the TaqMan Universal PCR Master Mix. The expression of mature miRNAs was normalized with internal control sno202 RNA (Assay ID: 001232).