Seqman

Manufactured by DNASTAR

Sourced in United States, Australia

SeqMan is a DNA sequence assembly software tool developed by DNASTAR. It provides a comprehensive set of features for assembling, aligning, and analyzing DNA sequence data from a variety of sources, including Sanger, Next-Generation, and long-read sequencing technologies.

Automatically generated - may contain errors

Lab products found in correlation

Megalign, by DNASTAR (17 mentions) Editseq, by DNASTAR (17 mentions) Abi prism 3730, by Thermo Fisher Scientific (12 mentions) Qiaquick pcr purification kit, by Qiagen (4 mentions) Seqbuilder, by DNASTAR (4 mentions) Dneasy blood tissue kit, by Qiagen (3 mentions) Bigdye terminator cycle sequencing kit, by Thermo Fisher Scientific (3 mentions) Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (3 mentions) Lasergene, by DNASTAR (3 mentions) Trizol, by Thermo Fisher Scientific (3 mentions) Abi 9700 thermal cycler, by Thermo Fisher Scientific (2 mentions) Exosap it, by GE Healthcare (2 mentions) Qiaquick gel extraction kit, by Qiagen (2 mentions) Primer premier 5, by Premier Biosoft (2 mentions) Sanger sequencing, by Macrogen (2 mentions) Ex taq dna polymerase, by Takara Bio (2 mentions) Bigdye terminator chemistry v 3, by Thermo Fisher Scientific (2 mentions) Abi 3130xl capillary sequencer, by Thermo Fisher Scientific (2 mentions) Taq dna polymerase, by Takara Bio (2 mentions) Dneasy blood and tissue kit, by Qiagen (2 mentions)

181 protocols using seqman

Sanger Sequencing Validation of Splice-Acceptor Mutations

Check if the same lab product or an alternative is used in the 5 most similar protocols

To validate true positive of the mutation, Sanger sequencing was performed. Primers flanking the candidate loci were designed based on the reference genomic sequences of Human Genome from GenBank in NCBI and synthesized by Invitrogen, Shanghai, China. PCR amplification was carried out in ABI 9700 Thermal Cycler. PCR products were directly sequenced on ABI PRISM 3730 automated sequencer (Applied Biosystems, Foster City, CA, USA). Sequence data comparisons and analysis were performed by DNASTAR SeqMan (DNASTAR, Madison, Wisconsin, USA).
The heterozygous novel splice-acceptor site mutations identified through targeted next generation sequencing were verified through Sanger sequencing using the primers: F1 5′-TTTACCAGTGAGGGACGGGC-3′, R1 5′-GTTTGTCTGGCTCCGGTAAGTA-3′. The reference sequence NM_000038 of APC was used.

Wang D., Liang S., Zhang Z., Zhao G., Hu Y., Liang S., Zhang X, & Banerjee S. (2017). A novel pathogenic splice acceptor site germline mutation in intron 14 of the APC gene in a Chinese family with familial adenomatous polyposis. Oncotarget, 8(13), 21327-21335.

+ Open protocol

+ Expand

Sanger Sequencing for Variant Validation

Check if the same lab product or an alternative is used in the 5 most similar protocols

To validate true positive of the mutation, Sanger sequencing was performed. Primers flanking the candidate loci were designed based on the reference genomic sequences of Human Genome from GenBank in NCBI and synthesized by Invitrogen, Shanghai, China. PCR amplification was carried out in ABI 9700 Thermal Cycler. PCR products were directly sequenced on ABI PRISM 3730 automated sequencer (Applied Biosystems, Foster City, CA, USA). Sequence data comparisons and analysis were performed by DNASTAR SeqMan (DNASTAR, Madison, Wisconsin, USA).
These two heterozygous novel nonsense mutations identified through targeted next generation sequencing were verified through Sanger sequencing using the primers: F1 5’-TTTACCAGTGAGGGACGGGC-3’, R1 5’-GTTTGTCTGGCTCCGGTAAGTA-3’. The reference sequence NM_001297 of CNGB1 was used.

Banerjee S., Yao J., Zhang X., Niu J, & Chen Z. (2017). Next generation sequencing identified novel heterozygous nonsense mutation in CNGB1 gene associated with retinitis pigmentosa in a Chinese patient. Oncotarget, 8(51), 88345-88350.

+ Open protocol

+ Expand

Phylogenetic analysis of hepatitis E virus

Check if the same lab product or an alternative is used in the 5 most similar protocols

The sequences obtained were analysed in the program DNAStar SeqMan in the DNAStar program package version 10.1.2 (DNA Star Inc, Madison, WI). The sequences were aligned with the corresponding region of 347 sequences representing HEV3 obtained from GenBank, and one moose HEV strain (Lin, Norder, Uhlhorn, Belak, & Widen, 2014) to root the tree. Phylogenetic analysis was carried out with the phylip package version 3.65 (Felsenstein, 1996). Evolutionary distances were calculated using the F84 algorithm in the DNADIST program with a transition/transversion ratio of 4.29. Boot strap analysis was performed on 1,000 replicas with the Seqboot program of the phylip package. Phylogenetic trees were constructed using the unweight pair‐group method using arithmetic averages (UPGMA) and the neighbour‐joining method in the NEIGHBOR program of the phylip package. The trees were visualized using the program treeview, version 1.6.6. All sequences obtained in the study are deposited in GenBank with accession numbers MK582523‐MK582474.

Wang H., Karlsson M., Lindberg M., Nyström K, & Norder H. (2019). Hepatitis E virus strains infecting Swedish domestic pigs are unique for each pig farm and remain in the farm for at least 2 years. Transboundary and Emerging Diseases, 66(3), 1314-1323.

+ Open protocol

+ Expand

Phylogenetic Analysis of Hepatitis E Virus

Check if the same lab product or an alternative is used in the 5 most similar protocols

The sequences obtained were analyzed with DNAStar SeqMan, package version 10.1.2 (DNA Star Inc., Madison, WI, USA). The sequences were aligned with the corresponding region of 347 sequences representing HEV3 and HEV4 obtained from GenBank. Phylogenetic analysis was carried out with the PHYLIP package version 3.65 [36 (link)]. Evolutionary distances were calculated using the F84 algorithm in the DNADIST program in the PHYLIP package with a transition-to-transversion ratio of 4.29. Phylogenetic trees were constructed using the unweight pair-group method using arithmetic averages (UPGMA) and the neighbor-joining method in the NEIGHBOR program of the PHYLIP package. The trees were visualized using the program Tree View, version 1.6.6. All sequences obtained in the study are deposited in GenBank with accession numbers KX757852–KX757878.

Roth A., Lin J., Magnius L., Karlsson M., Belák S., Widén F, & Norder H. (2016). Markers for Ongoing or Previous Hepatitis E Virus Infection Are as Common in Wild Ungulates as in Humans in Sweden. Viruses, 8(9), 259.

+ Open protocol

+ Expand

Sanger Sequencing for Mutation Validation

Check if the same lab product or an alternative is used in the 5 most similar protocols

To validate true positive of the mutation, Sanger sequencing was performed. Primers flanking the candidate loci (Forward primer 5’-CCGCCCCAGGACAAGTAAAT-3’, Reverse primer 5’-GGAGGAGCTGTTGAAGCCAT-3’) were designed based on the reference genomic sequences of Human Genome from GenBank in NCBI and synthesized by Invitrogen, Shanghai, China. PCR amplification was carried out in ABI 9700 Thermal Cycler. PCR products were directly sequenced on ABI PRISM 3730 automated sequencer (Applied Biosystems, Foster City, CA, USA). Sequence data comparisons and analysis were performed by DNASTAR SeqMan (DNASTAR, Madison, Wisconsin, USA).

Dai Y., Liang S., Huang Y., Chen L, & Banerjee S. (2016). Targeted next generation sequencing identifies two novel mutations in SEPN1 in rigid spine muscular dystrophy 1. Oncotarget, 7(51), 83843-83849.

+ Open protocol

+ Expand

Sanger Sequencing Validation of Splice-Acceptor Mutations

Check if the same lab product or an alternative is used in the 5 most similar protocols

Zhang Z., Liang S., Wang D., Liang S., Li Y., Wang B., jiang T., Zhao G., Zhang X, & Banerjee S. (2017). A novel pathogenic single nucleotide germline deletion in APC gene in a four generation Chinese family with familial adenomatous polyposis. Scientific Reports, 7, 12357.

+ Open protocol

+ Expand

Validating Mutation Through Sanger Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

To validate putative mutations, Sanger sequencing was performed. Primers flanking the candidate loci were designed based on the reference genomic sequences of the Human Genome from GenBank in NCBI and synthesized by Invitrogen, Shanghai, China. PCR amplification was carried out in an ABI 9700 Thermal Cycler. PCR products were directly sequenced on an ABI PRISM 3730 automated sequencer (Applied Biosystems, Foster City, CA). Sequence data comparisons and analysis were performed by DNASTAR SeqMan (DNASTAR, Madison, Wisconsin).
These novel mutations identified through whole exome sequencing was verified through Sanger sequencing using the following primers: F1 5′‐GACCAAGATGCTTCAGACGG‐3′, R1 5′‐GCAATTGGCCAGATTAGGA‐3′; F2 5′‐GTTCAGCAACGTCGCCAG‐3′, R2 5′‐GTTAACGGTCATCAGCGGG‐3′; F3 5′‐GTACACCGGATCGAAGGCTG‐3′, R3 5′‐GTACGCTTTGACGTCGG‐3′. The reference sequence NM_004006 of DMD was used.

Zhang Y., Yang W., Wen G., Wu Y., Jing Z., Li D., Tang M., Liu G., Wei X., Zhong Y., Li Y, & Deng Y. (2019). Application whole exome sequencing for the clinical molecular diagnosis of patients with Duchenne muscular dystrophy; identification of four novel nonsense mutations in four unrelated Chinese DMD patients. Molecular Genetics & Genomic Medicine, 7(5), e622.

+ Open protocol

+ Expand

Sanger Sequencing for Mutation Validation

Check if the same lab product or an alternative is used in the 5 most similar protocols

To validate true positive of the mutation, Sanger sequencing was performed. Primers flanking the candidate loci were designed based on the reference genomic sequences of Human Genome from GenBank (GenBank Accession: NM_000267.3) in NCBI and synthesized by Invitrogen, Shanghai, China. PCR amplification was carried out in ABI 9700 Thermal Cycler. PCR products were directly sequenced on ABI PRISM 3730 automated sequencer (Applied Biosystems, Foster City, CA, USA). Sequence data comparisons and analysis were performed by DNASTAR SeqMan (DNASTAR, Madison, Wisconsin, USA).
The details of primer sequence are given in Table 2.

Banerjee S., Lei D., Liang S., Yang L., Liu S., Wei Z, & Tang J.P. (2016). Novel phenotypes of NF1 patients from unrelated Chinese families with tibial pseudarthrosis and anemia. Oncotarget, 8(24), 39695-39702.

+ Open protocol

+ Expand

Sanger Sequencing Validation of WES Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols

Sanger sequencing was performed for the proband as well as for her parents to validate the identi ed variants in WES. Primer pairs were designed for the candidate loci on the basis of reference genomic sequences of the Human Genome from GenBank in NCBI. Primers were synthesized (Invitrogen, Shanghai, China) and polymerase chain reaction (PCR) has been done by using an ABI 9700 Thermal Cycler. Then, PCR products were directly sequenced by an ABI PRISM 3730 automated sequencer (Applied Biosystems, Foster City, CA, USA). Sequencing data analysis was performed by DNASTAR SeqMan (DNASTAR, Madison, Wisconsin, USA).
Sanger sequencing validated the identi ed heterozygous variants by WES by using the following primers:
F1 5'-GCGCGGATCTCAGCATGCGCGG-3', R1 5'-GGGGTCTCCGCGGCTCCCCGG-3'; F1 5'-GGCGCTAGGGTCGAAGGCGGCG-3', R1 5'-GGTCTCGGTAGGCGCGTACTGG-3' The reference sequence NM_000456 of SUOX gene was used.

Zhang R., Hao Y., Xu Y., Qin J., Wang Y., Dey S.K., Li C., Wang H., & Banerjee S. (2020). Whole Exome Sequencing Identified Novel Mutation in SUOX Gene Causes Extremely Rare Autosomal Recessive Isolated Sulfite Oxidase Deficiency.

+ Open protocol

+ Expand

Validating novel RAG1 variant by Sanger

Check if the same lab product or an alternative is used in the 5 most similar protocols

To validate the identified variants by WES, we performed Sanger sequencing. Designing primer pairs for the candidate loci have been done based on the reference genomic sequences of the Human Genome from GenBank in NCBI. Primer pairs were synthesized by Invitrogen, Shanghai, China. Polymerase chain reaction (PCR) was performed with an ABI 9700 Thermal Cycler. Next, directly sequenced the PCR products by an ABI PRISM 3730 automated sequencer (Applied Biosystems, Foster City, CA, USA). Analysis of sequencing data has been done by DNASTAR SeqMan (DNASTAR, Madison, Wisconsin, USA).
WES identified the novel homozygous variant, which was validated by Sanger sequencing using the following primers: F1 5′-GGCGCGGGGGTCTCGCGGCG-3′ , R1 5′-GGCGGCGAATTCTATAGCG-3′ . The reference sequence NM_000448.2 of RAG1 was used.

Wang W., Wang J., Wang J., Liu J., Pei J., Li W., Wang Y., Banerjee S., Xu R., Meng Z, & Yi B. (2022). Whole-exome sequencing identified a homozygous novel RAG1 mutation in a child with omenn syndrome. Allergologia et immunopathologia, 50(6).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!