To produce conditional medium (CM), MC38, KPC1, KPC3, and B16F10 cells were washed two times with PBS at 70–80% confluency and incubated in serum-free DMEM medium for 24 h. CM was then collected and passed through a 0.45-mm Syringe Filter (SLHP033RB, Merck Millipore, Billerica, MA, USA). HEK293 cells were seeded at approximately 5 × 104 cells per well into a 24-well plate. The next day, cells in each well were co-transfected with 0.1 µg TGF-β/SMADinducible (CAGA)12 luciferase transcriptional reporter construct, which encodes 12 repeats of the AGCCAGACA sequence (identified as a SMAD3/SMAD4-binding element in the human PAI-1 promoter [39 (link)]), and 0.08 µg β-galactosidase construct (driven by a cytomegalovirus promoter) using five times of polyethyleneimine in quantity. After overnight incubation, HEK293 cells were starved with serum free medium. Eight hours later, serum free media were removed and replaced by CM. A TGF-β treatment (5 ng/mL, 8420-B3, R&D SYSTEMS, Minneapolis, MN, USA) was also performed that served as a standard. After another overnight incubation, luciferase and β-galactosidase activities were measured. The luciferase activity was normalized based on the β-galactosidase activity. Representative experiments indicating the mean and standard deviation of triplicate values are shown.
Slhp033rb
Manufactured by Merck Group
Sourced in United States
SLHP033RB is a laboratory equipment product from Merck Group. It is a high-performance instrument designed for specific laboratory applications. The core function of this product is to perform precise measurements and analyses within the confines of a controlled laboratory environment.
Automatically generated - may contain errors
Lab products found in correlation
Basemuncher endonuclease, by Abcam (7 mentions)
7500 fast real time pcr system, by Thermo Fisher Scientific (6 mentions)
Rna extraction kit, by Bioer (4 mentions)
Pmd2 g, by Addgene (2 mentions)
Byq6.6.101711 213, by Thermo Fisher Scientific (2 mentions)
Polyethyleninime, by Polysciences (2 mentions)
Gag pol expression plasmid, by Addgene (2 mentions)
Pspax2, by Addgene (2 mentions)
Lenti x concentrator, by Takara Bio (1 mentions)
Pmdlg prre, by Addgene (1 mentions)
Prsv rev, by Addgene (1 mentions)
Anti vsv g antibody, by American Type Culture Collection (1 mentions)
Facscanto 2 flow cytometer, by BD (1 mentions)
Neomycin, by InvivoGen (1 mentions)
Blasticidin, by InvivoGen (1 mentions)
Puromycin, by InvivoGen (1 mentions)
E607008 0500, by Sangon (1 mentions)
Pcmv vsv g, by Addgene (1 mentions)
Lipo293, by Beyotime (1 mentions)
Multimode microplate reader, by PerkinElmer (1 mentions)
23 protocols using slhp033rb
1
TGF-β/SMAD Transcriptional Activity Assay
2
Lentiviral Vector Production in 293T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
On day 0, 1.5 × 107 293T cells were seeded in a 150-mm dish. Next day, eight different CD19 CAR, FITC CAR, and luciferase vectors were co-transfected with lentiviral packaging plasmids, pRSV-Rev (12253; Addgene, Watertown, MA, USA), pMDLg/pRRE (12251; Addgene) and pMD2.G (12259; Addgene) to 293T cells. On day 2, the medium of transfected 293T cells was replaced with fresh medium. On day 3–4, lentivirus supernatants were collected from the transfected 293T cells and were filtered with 0.45 μm a polyethersulfone (PES) membrane filter (SLHP033RB; Merck Millipore, Burlington, MA, USA). If necessary, lentivirus supernatants were concentrated using Lenti-X concentrator (631232; Clontech).
3
Conditioning MDA-MB-231 and MCF7 Cells for TGFβ3 Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MDA-MB-231 and MCF7 cells were grown to 70–80% confluency, washed two times with PBS, and incubated in serum-free DMEM for 24 h. Conditioned medium (CM) was then collected and passed through a 0.45-mm syringe filter (SLHP033RB, Merck Millipore).
19TT cells were treated with CM, recombinant human TGFβ3 (5 ng/ml, 8420-B3, R&D SYSTEMS and Andrew P. Hinck, University of Pittsburg, USA), interleukin 1β (IL1β, 10 ng/ml, 201-LB, R&D SYSTEMS), or tumor necrosis factor α (TNFα, 10 ng/ml, 210-TA, R&D SYSTEMS) for 1, 3, 6, 12, and 24 h. Buffer-treated controls were used in parallel. For antibody neutralization assays, TGFβ3 or CM was incubated with control (13C4) or TGFβ-neutralizing (1D11) antibody (generously provided by Sanofi Genzyme, Inc.) for 30 min (min) before treatment.
For inhibition of BMP signaling by recombinant human Grem1 (rhGrem1, 5190-GR, R&D SYSTEMS), rhGrem1 was pre-incubated with recombinant human BMP2/6 (5 ng/ml, 355-BM/507-BP, R&D SYSTEMS) for 30 min.
19TT cells were treated with CM, recombinant human TGFβ3 (5 ng/ml, 8420-B3, R&D SYSTEMS and Andrew P. Hinck, University of Pittsburg, USA), interleukin 1β (IL1β, 10 ng/ml, 201-LB, R&D SYSTEMS), or tumor necrosis factor α (TNFα, 10 ng/ml, 210-TA, R&D SYSTEMS) for 1, 3, 6, 12, and 24 h. Buffer-treated controls were used in parallel. For antibody neutralization assays, TGFβ3 or CM was incubated with control (13C4) or TGFβ-neutralizing (1D11) antibody (generously provided by Sanofi Genzyme, Inc.) for 30 min (min) before treatment.
For inhibition of BMP signaling by recombinant human Grem1 (rhGrem1, 5190-GR, R&D SYSTEMS), rhGrem1 was pre-incubated with recombinant human BMP2/6 (5 ng/ml, 355-BM/507-BP, R&D SYSTEMS) for 30 min.
4
VSV-based SARS-CoV-2 Pseudovirus Production
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The original SARS-CoV-2, and VOC pseudoviruses were constructed with a GFP encoding replication-deficient vesicular stomatitis virus (VSV) vector backbone (VSV-ΔG-GFP) and the coding sequence of corresponding spike proteins, as previously described (Muik et al., 2021 (link)). Briefly, HEK293T cells were transfected by 30 ng of spike protein expression plasmids. The VSV-ΔG-GFP pseudovirus was added 24 h post-transfection. The inoculum was removed after incubation for 1 h at 37°C. The culture medium was then changed into DMEM supplemented with 10% FBS and 10 lg/mL of anti-VSV-G antibody (I1-Hybridoma ATCC CRL2700TM) after washing cells with PBS. The pseudoviruses were harvested 20 h post-inoculation, passed through a 0.45-lm filter (Millipore, Cat#SLHP033RB) before aliquoted, and stored at −80°C.
All pseudoviruses were treated with 0.5 U/μL BaseMuncher Endonuclease (Abcam, ab270049) for 1.5 h at 37°C to remove unpackaged RNA before quantification. Viral RNA was extracted (Bioer Technology, Cat# BYQ6.6.101711-213) and quantitated by quantitative RT–PCR (qPCR) using 7500 fast real-time PCR system (Applied Biosystems) with the primers and probe for detecting the P protein coding sequence of VSV.
All pseudoviruses were treated with 0.5 U/μL BaseMuncher Endonuclease (Abcam, ab270049) for 1.5 h at 37°C to remove unpackaged RNA before quantification. Viral RNA was extracted (Bioer Technology, Cat# BYQ6.6.101711-213) and quantitated by quantitative RT–PCR (qPCR) using 7500 fast real-time PCR system (Applied Biosystems) with the primers and probe for detecting the P protein coding sequence of VSV.
5
Pseudovirus Construction Protocol for SARS-CoV-2 Evaluation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SARS-CoV-2, GX/P2V/2017 and GD/1/2019 pseudoviruses were constructed with a GFP-encoding replication-deficient vesicular stomatitis virus (VSV) vector backbone (VSV-ΔG-GFP) and the coding sequence of the corresponding spike proteins, as previously described.30 (link)
,34 (link) Briefly, HEK-293T cells were transfected with 30 μg of spike protein expression plasmids and the VSV-ΔG-GFP pseudovirus was added 24 h later. The inoculum was removed after incubating for 1 h at 37°C. After washing the cells with PBS, the culture medium was changed into DMEM supplemented with 10% FBS and 10 μg/mL of anti-VSV-G antibody (I1Hybridoma ATCC® CRL2700™). The pseudoviruses were harvested 20 h post inoculation, passed through a 0.45 μm filter (Millipore, Cat#SLHP033RB), aliquoted and stored at −80°C.
,34 (link) Briefly, HEK-293T cells were transfected with 30 μg of spike protein expression plasmids and the VSV-ΔG-GFP pseudovirus was added 24 h later. The inoculum was removed after incubating for 1 h at 37°C. After washing the cells with PBS, the culture medium was changed into DMEM supplemented with 10% FBS and 10 μg/mL of anti-VSV-G antibody (I1Hybridoma ATCC® CRL2700™). The pseudoviruses were harvested 20 h post inoculation, passed through a 0.45 μm filter (Millipore, Cat#SLHP033RB), aliquoted and stored at −80°C.
6
SARS-CoV-2 Pseudovirus Production and Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The SARS‐CoV‐2, GX/P2V/2017, and GD/1/2019 pseudoviruses were constructed with a GFP encoding replication‐deficient vesicular stomatitis virus (VSV) vector backbone (VSV‐ΔG‐GFP) and the coding sequence of corresponding spike proteins, as previously described (Li et al, 2020 (link); Muik et al, 2021 (link)). Briefly, HEK 293T cells were transfected by 30 μg of spike protein expression plasmids. The VSV‐ΔG‐GFP pseudovirus was added 24 h post‐transfection. The inoculum was removed after incubation for 1 h at 37°C. The culture medium was then changed into DMEM supplemented with 10% FBS and 10 μg/ml of anti‐VSV‐G antibody (I1‐Hybridoma ATCC® CRL2700™) after washing cells with PBS. The pseudoviruses were harvested 20 h post‐inoculation, passed through a 0.45‐μm filter (Millipore, Cat#SLHP033RB) before aliquoted, and stored at −80°C.
All pseudoviruses were treated with 0.5 U/μl BaseMuncher Endonuclease (Abcam, ab270049) for 1.5 h at 37°C to remove unpackaged RNA before quantification. Viral RNA was extracted (Bioer Technology, Cat# BYQ6.6.101711‐213) and quantitated by quantitative RT–PCR (qPCR) using 7500 fast real‐time PCR system (Applied Biosystems) with the primers and probe for detecting the P protein coding sequence of VSV.
All pseudoviruses were treated with 0.5 U/μl BaseMuncher Endonuclease (Abcam, ab270049) for 1.5 h at 37°C to remove unpackaged RNA before quantification. Viral RNA was extracted (Bioer Technology, Cat# BYQ6.6.101711‐213) and quantitated by quantitative RT–PCR (qPCR) using 7500 fast real‐time PCR system (Applied Biosystems) with the primers and probe for detecting the P protein coding sequence of VSV.
7
Production and Titration of SARS-CoV-2 Pseudoviruses
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RaTG13 and SARS-CoV-2 pseudoviruses were constructed with a GFP-encoding replication-deficient vesicular stomatitis virus (VSV) vector backbone (VSV-ΔG-GFP) and the coding sequence of corresponding spike proteins, as previously described (Li et al., 2020a (link); Muik et al., 2021 (link)). HEK293T cells were transfected with 30 μg of the spike protein expression plasmids. The VSV-ΔG-GFP pseudovirus was added 24h post-transfection. The inoculum was removed after incubation for 1 h at 37°C. The culture medium were then changed into DMEM supplemented with 10% FBS and 10 μg/mL of anti-VSV-G antibody (I1Hybridoma ATCC® CRL2700) after washing the cells with PBS. The pseudoviruses were harvested 20 h post-inoculation, passed through a 0.45 μm filter (Millipore, Cat#SLHP033RB) before aliquoted and stored at −80°C.
All pseudoviruses were treated with 0.5U/μL BaseMuncher endonuclease (Abcam, ab270049) for 1.5 h at 37°C to remove unpackaged RNA before quantification. Viral RNA was extracted (Bioer Technology, Cat# BYQ6.6.101711-213) and quantified by quantitative RT-PCR (qPCR) using 7500 fast Real-Time PCR System (Applied Biosystems) with the primers and probe for detecting the P protein coding sequence of VSV.
All pseudoviruses were treated with 0.5U/μL BaseMuncher endonuclease (Abcam, ab270049) for 1.5 h at 37°C to remove unpackaged RNA before quantification. Viral RNA was extracted (Bioer Technology, Cat# BYQ6.6.101711-213) and quantified by quantitative RT-PCR (qPCR) using 7500 fast Real-Time PCR System (Applied Biosystems) with the primers and probe for detecting the P protein coding sequence of VSV.
8
Generating SARS-CoV-2 Spike Pseudoviruses for Research
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Pseudoviruses containing SARS-CoV-2 variant S protein and the backbone of deficient vesicular stomatitis virus (VSV) vector (VSV-ΔG-GFP) (BrainVTA) were generated using the previously described protocols47 (link),48 . In brief, 30 μg of S plasmid with a C terminal 18 amino acids truncation was transfected into HEK293T cells cultured in a 10 cm dish, then after 24 h the VSV-ΔG-GFP pseudoviruses were added into the cell supernatant. The inoculum was then removed following incubation at 37 °C for 2 h and the cells were washed with PBS and cultured in DMEM supplemented with both 10% FBS and anti-VSV-G antibody (produced by I1Hybridoma ATCC® CRL2700™). Then 20 h post-infection, the supernatants were harvested, filtered (0.45 μm filter, Millipore, Cat#SLHP033RB), aliquoted, and stored at −80 °C.
Prior to quantification, the unpackaged RNA in the SARS-CoV-2 pseudoviruses was removed using a 0.5 U/μL BaseMuncher endonuclease (Abcam) treatment at 37 °C for 1.5 h. Viral RNA was extracted using an RNA extraction kit (Bioer Technology) and quantified using a quantitative RT-PCR assay performed using a 7500 Fast Real-Time PCR system (Applied Biosystems). The primers and probe used to detect the L gene of the VSV virus are as described in the literature49 (link): VSV-F: TGATACAGTACAATTATTTTGGGAC; VSV-R: GAGACTTTCTGTTACGGGATCTGG; VSV-probe: FAM-ATGATGCATGATCCWGC-TAMRA.
Prior to quantification, the unpackaged RNA in the SARS-CoV-2 pseudoviruses was removed using a 0.5 U/μL BaseMuncher endonuclease (Abcam) treatment at 37 °C for 1.5 h. Viral RNA was extracted using an RNA extraction kit (Bioer Technology) and quantified using a quantitative RT-PCR assay performed using a 7500 Fast Real-Time PCR system (Applied Biosystems). The primers and probe used to detect the L gene of the VSV virus are as described in the literature49 (link): VSV-F: TGATACAGTACAATTATTTTGGGAC; VSV-R: GAGACTTTCTGTTACGGGATCTGG; VSV-probe: FAM-ATGATGCATGATCCWGC-TAMRA.
9
Production of SFTSV iVLP
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293T cells were cotransfected with the expression plasmids for SFTSV GP, RdRp and N, along with the MUTR-Luc transcription plasmid. At 48 h posttransfection, the cell culture medium containing the packaged iVLP was centrifugated (1,250 rpm, 5 min) and filtered with 0.45 μm filter membrane (Millipore, Cat#SLHP033RB) before usage for infection.
10
Generation of SARS-CoV-2 Pseudoviruses
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To obtain SARS-CoV-2 PT and variants pseudoviruses, we constructed replication-deficient vesicular stomatitis virus vector backbone (VSV-ΔG-GFP) expressing the corresponding spike proteins. 30 mg of spike protein expression plasmids were transfected into HEK293T cells each 10 cm culture dish. After 24 h, The VSV-ΔG-GFP pseudoviruses were added to the transfected cell supernatant. After incubation for 2 h at 37 °C, inoculum was replaced with fresh DMEM containing both 10% FBS and anti-VSV-G antibody produced by I1HybridomaATCC®-CRL2700™. The pseudovirues were obtained 30 h post-infection. After being filtered by 0.45 mm filters (Millipore, Cat#SLHP033RB), the pseudoviruses were aliquoted and stored at −80 °C.
0.5 U/mL BaseMuncher endonuclease (Abcam) was used to remove unpackaged RNA at 37 °C for 1 h. Viral RNA was extracted using an RNA extraction kit (Bioer Technology) and quantified by quantitative RT-PCR.
0.5 U/mL BaseMuncher endonuclease (Abcam) was used to remove unpackaged RNA at 37 °C for 1 h. Viral RNA was extracted using an RNA extraction kit (Bioer Technology) and quantified by quantitative RT-PCR.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!