Genomic DNA was extracted from putative DAG1KO clones using QuickExtract lysis buffer (Biosearch Technologies, Hoddesdon, UK). The Cas9-targeted region was amplified using KOD polymerase. After gel extraction, PCR products were 3′ adenylated by incubating the gel-purified KOD PCR product with Taq-containing MangoMix (Bioline, London, UK) at 72 °C for 30 min. PCR products were PCR purified (Qiagen, Hilden, Germany) and ligated into the TOPO-TA vector (ThermoFisher Scientific, Waltham, MA, USA). Then, the ligated products were transformed into bacteria. At least 10 TOPO-TA colonies from each DAG1KO clone were Sanger sequenced to determine zygosity.
Topo ta vector
Manufactured by Thermo Fisher Scientific
Sourced in United States, Germany
The TOPO-TA vector is a cloning vector designed for the rapid and efficient insertion of PCR products into a plasmid. It utilizes the topoisomerase I-mediated ligation reaction to directly clone Taq polymerase-amplified DNA fragments without the need for restriction enzymes or ligase. The vector provides a simple and convenient method for the direct cloning of PCR products.
Automatically generated - may contain errors
Lab products found in correlation
Qiaquick gel extraction kit, by Qiagen (5 mentions)
Dneasy blood and tissue kit, by Qiagen (3 mentions)
Ez dna methylation lightning kit, by Zymo Research (3 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Amplitaq gold 360, by Promega (3 mentions)
Epitect bisulfite kit, by Qiagen (3 mentions)
Qiaquick pcr purification kit, by Qiagen (2 mentions)
Faststart taq dna polymerase, by Roche (2 mentions)
Accuprime taq dna polymerase high fidelity, by Thermo Fisher Scientific (2 mentions)
Dual luciferase assay, by Promega (2 mentions)
Psicheck 2 plasmid, by Promega (2 mentions)
M mlv rt kit, by Promega (2 mentions)
Ez dna methylation gold kit, by Zymo Research (2 mentions)
Qiaamp dna mini kit, by Qiagen (2 mentions)
Top10 chemically competent escherichia coli cells, by Thermo Fisher Scientific (2 mentions)
Pbpnlslexa p65uw, by Addgene (2 mentions)
Cobas taqman hcv test v2, by Roche (1 mentions)
Qiaamp dna blood mini kit, by Qiagen (1 mentions)
Anti flag, by Merck Group (1 mentions)
Protein g dynabead, by Thermo Fisher Scientific (1 mentions)
100 protocols using topo ta vector
1
Genotyping CRISPR-Cas9 Edited Clones
2
Bisulfite Sequencing of ABHD2 Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Methylation was analyzed by bisulfite PCR sequencing of cloned alleles. We extracted DNA from two ovarian cancer cell lines, A2780 and HEYA8, and from HGSOC tissue of eight patients using the DNeasy Blood and Tissue Kit (Qiagen). Two μg DNA was modified with sodium bisulfite treatment using the Bisulfite Kit (Qiagen) according to the manufacturer's protocol. We designed forward and reverse primers (Supplementary Table S1 ) that were used to amplify bisulfite modified DNA across the ABHD2 promoter region. PCR products were purified using the QIAquick PCR Purification Kit (Qiagen), cloned into the TOPO-TA vector (Thermo Fisher Scientific) and sequenced following the manufacturer's standard protocol. Between 13 and 20 clones were sequenced for each sample.
3
HCV Resistance Assay Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Blood samples for resistance assays were collected from all participants at the baseline visit, at the time of virologic failure or at the end-of-treatment visit and at follow-up visits at weeks 4, 12 and 24. Plasma HCV RNA levels were measured using the Roche COBAS® Taqman® HCV Test v2.0, which has a lower limit of quantitation of 25 IU/mL. To assess the presence of polymorphisms at baseline or time of virologic failure, the HCV NS3/4A gene was amplified using the reverse transcriptase-polymerase chain reaction (PCR) followed by consensus Sanger and selective clonal sequencing. Due to the sensitivity of the consensus sequencing assay, resistance analysis was performed only on samples from participants with HCV viral loads >1000 IU/mL. The limit of variant detection using consensus Sanger sequencing was >25% of viral quasispecies. For clonal sequencing, PCR amplification was performed only on the NS3 protease region (amino acids 1–181) and the resultant amplicons cloned into a TOPO TA vector (Thermo Fisher Scientific, Waltham, MA, USA). Approximately 40 clones were sequenced at each time point and resultant amino acid sequences were compared with wild-type (WT) HCV GT1a (H77) or GT1b (Con1) reference sequences.
4
Soil Amoebae DNA Extraction and Identification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA extractions from soil amoebae were performed using the UNSET protocol [17 ] or QIAamp DNA Blood Mini Kit (Qiagen). Identification of amoeba isolates was performed by PCR using common amoeba primers AmeF977 (GATYAGATACCGTCGTAGTC) and AmeR1534 (TCTAAGRGCATCACAGACCTG) [18 (link)] or Acanthamoeba specific primers JDP1 (GGCCCAGATCGTTTACCGTGAA) and JDP2 (TCTCACAAGCTGCTAGGGAGTCA) [19 (link)]. PCR fragments were purified and cloned into the TOPO TA vector (Thermo Fisher) and transformed into DH5-α E. coli. At least three plasmid clones were purified and Sanger-sequenced for each amoeba isolate. Sequences were blasted against GenBank and deposited under BioProject 506281. All the sequences for clones derived from each one of the 7 isolates resulted in the same BLAST hits.
5
Quantifying TDP-43 Binding to GRN 3'UTR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 3′UTR region sequence of human GRN (322 pb) was amplified by RT-PCR from SK-N-BE total RNA using the primers listed in Supplementary Table S2 , cloned into the TOPO TA vector (Thermo Fisher Scientific) downstream of the T7 promoter and linearized (0.5 μg) by HindIII restriction enzyme (30 U) for in vitro transcription. The mouse Grn 3′UTR probe [7 (link)] was used as a positive control. UV-crosslinking was performed using HEK293T protein lysates (200 μg) transfected with human Flag-TDP-43 and 32P-radiolabeled riboprobes, as previously described [46 (link)]. Immunoprecipitation was conducted on UV-crosslinked samples using the anti-FLAG (2 μg; Sigma-Aldrich) or the anti-IgG antibodies (2 μg, SantaCruz Biotechnology) (Supplementary Table S1 ) and protein G Dynabeads (Thermo Fisher Scientific). Immunocomplexes were washed several times in PBS with 0.02% Tween-20, run on a 10% SDS-PAGE gel and analyzed by autoradiography.
6
Quantifying DNA Methylation in Mouse D4Z4 Repeat
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA (400 ng) from mouse tail was bisulphite converted with the EZ DNA Methylation-Lightning kit (Zymo Research; BaseClear Lab Products, Leiden, the Netherlands) following the instructions of the manufacturer. A PCR reaction of the DR1 region within the D4Z4 repeat transgene and a PCR reaction of the FasPas region just distal of the D4Z4 repeat transgene was performed using FastStart Taq DNA polymerase (Roche, Woerden, the Netherlands) with the following cycling conditions: initial denaturation for 10 min at 95 °C followed by 35 cycles of 20 seconds at 95 °C, 30 seconds at 60 °C and 40 seconds at 72 °C, with a final extension step for 5 min at 72 °C. Next, the PCR products were ligated into the TOPO TA vector (Thermo Fisher Scientific, Bleiswijk, the Netherlands), followed by transformation of the ligation products into competent DH5α bacteria. Plasmid DNA from at least 10 individual colonies was isolated and sent for Sanger sequencing.
7
Bisulfite Treatment and Sequencing of DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bisulfite treatment of 500 ng DNA was done using the Zymo EZ DNA Methylation-Lightning Kit (Zymo Research, cat #D5031) with their standard protocol. Two microliters of bisulfite-treated DNA was amplified using bisulfite-specific PCR primers. PCR products were purified using the Nucleospin Gel and PCR clean-up kit (Macherey-Nagel, cat# 740609). Purified products were either directly sequenced using Sanger sequencing and chromatograph traces analyzed with the ESME analysis software [35 (link)] or first cloned into the TOPO-TA vector (ThermoFisher, cat# 450641) where single colonies were miniprepped and sequenced using sanger sequencing.
8
Cloning and Validation of Mouse and Human FcRn
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse FcRn specific cloning primers, sense: 5′ GGTACC CCACC ATG GGG ATG CCA CTG CCC T 3′, antisense: 5′ GCGGCCGC TCA CTT GTC ATC TTT GTA GTC GGA AGT GGC TGG AAA GGC ATT TGC A 3′ (italic letters indicate FLAG-tag sequence), human FcRn cloning primers, sense: 5′ GGTACC CCACC ATG GGG GTC CCG CGG 3′, antisense: 5′ GCGGCCGC TCA GGC GGT GGC TGG AAT CAC ATT TA 3′, were designed to amplify the full sequence using RT-PCR. The restriction enzyme sites for KpnI and NotI were included in the primers to facilitate directional cloning into the VVPW plasmid. The PCR product(s) was first cloned into topo-TA vector (ThermoFisher, Cat # K4575J10) and the resulted clones were validated by sequencing (Quintara Biosciences, Hayward, CA, USA).
9
Bisulfite Conversion and Methylation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bisulfite conversion of genomic DNA was carried out using the EZ DNA Methylation-Lightning kit (Zymo Research, #D5030) according to the manufacturer’s protocol. Converted DNA was used to amplify the DR1 region using FastStart™ Taq DNA polymerase (Sigma-Aldrich, #12032902001) with the following primers: 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGGGTTGAGGGTTGGGTTTATA-3' and 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGACAAAACTCAACCTAAAAATATAC-3'. Converted DNA was amplified at the FAS-PAS region with AccuPrime™ Taq high fidelity DNA Polymerase (Thermo Fisher Scientific, #12346086) with the following primers: 5'-ATAGGGAGGGGGTATTTTA-3' and 5'-ACRATCAAAAACATACCTCTATCTA-3'.
PCR products were resolved on 2% TBE agarose gel, gel extracted with NucleoSpin Gel & PCR Clean-up kit (Bioke, #740609) and subcloned into the TOPO-TA vector (Thermo Fisher Scientific, #45-064-1) according to manufacturer’s protocol. Plasmids were isolated from independent bacterial colonies and sent for Sanger sequencing (Macrogen). BiQ Analyzer software was used for the methylation analysis.
PCR products were resolved on 2% TBE agarose gel, gel extracted with NucleoSpin Gel & PCR Clean-up kit (Bioke, #740609) and subcloned into the TOPO-TA vector (Thermo Fisher Scientific, #45-064-1) according to manufacturer’s protocol. Plasmids were isolated from independent bacterial colonies and sent for Sanger sequencing (Macrogen). BiQ Analyzer software was used for the methylation analysis.
10
Cloning and Sequencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The amplified gene was ligated to the Topo TA Vector with a cloning kit (Thermo Fisher Scientific) and competent E. coli cells (DH5 alpha strain) were transformed. The gene was completely sequenced.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!