Twelve sgRNAs were designed using the CRISPR design tool from Synthego (https://design.synthego.com/ ) using Danio rerio (GRCz11) genome and selecting top rank sgRNAs with high activity and minimal off targets (Doench et al., 2016 (link)) (Supplementary Table 2). Negative Control, Scrambled sgRNA #1, GCACUACCAGAGCUAACUCA (Synthego) was used as a negative control in pilot experiments.
Crispr design tool
Manufactured by Synthego
The CRISPR design tool is a software application that helps users design and analyze CRISPR guide RNA sequences. It provides a platform for identifying potential target sites, evaluating on-target and off-target activity, and optimizing CRISPR constructs for various applications.
Automatically generated - may contain errors
Lab products found in correlation
9 protocols using crispr design tool
1
CRISPR sgRNA Design for Zebrafish
2
Inducible SOX17 and Knockout Cell Lines
3
Inducible SOX17 and Knockout Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We generated an inducible SOX17 cell line using the PiggyBac system (Park et al., 2018a (link)). Human SOX17 CDS was cloned into PiggyBac transposon vector (Transposagen) downstream of TREtight promoter of pTRE-P2A-Venus-rpEF1 α-Zeo plasmid, and co-transfected with pEF1 α-M2rtTA-T2A-Puro and transposase plasmid into H9 hESCs using human stem cell nucleofector kit 2 (Lonza). Cells were selected in Zeocin (0.5 μg/ml, Thermofisher) and Puromycin (0.5 μg/ml, Sigma) for 10 days and resistant clones screened for Venus expression following DOX (Sigma) treatment. To generate SOX17−/− knockout H9 ESC line, two single guide RNAs were designed in CRISPR design tool (Synthego). Two sgRNA sequences are listed in the key resources table . H9 ESCs were electroporated with the two sgRNAs and Cas9 protein (PNA Bio), and then plated at a low density on 6 well plate. After 7 days, individual colonies were picked and further expanded. After expansion, individual clones were screened by genomic PCR for the acquisition of 830 bp deletion in wild-type SOX17 allele using primers P1 and P2.
4
Designing CRISPR sgRNAs for Canine p53
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two synthetic guide RNAs (sgRNA) were designed using Synthego CRISPR Design tool for the tumor protein p53 gene (TP53, Gene ID: 403869) of the dog (Canis lupus familiaris), in exon 4: (1) G*A*C*CGUCCAAGUAACAGACU and (2) A*G*C*CAAGUCUGUUACUUGGA. Both sgRNAs were synthesized by Synthego (USA).
5
CRISPR Genome Editing Workflow
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For this study the following software and web tools were used: CRISPR Design software, developed by Zhang at the MIT Laboratory in 201526 (link), and CRISPR design tool from SYNTHEGO, for the design of sgRNAs; Primer-BLAST (NCBI), for the design of primers to be used in PCR reactions; Verify Guide Design (SYNTHEGO) for the identification of off-target sites of G3 and G8 sgRNAs; Galaxy platform31 (link) and Integrative Genomics Viewer (IGV) tool32 (link) for on-target NGS analysis; GraphPad Prism 7.00, for statistical analysis.
6
Optimizing CRISPR gRNA Design and Screening
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Guide RNAs (gRNAs) were designed using the CRISPR Design Tool (Synthego). For each target, four custom gRNAs were purchased from the company Synthego and tested using an in vitro incubation assay with Cas9 enzyme using PCR amplified and purified DNA from the target region. Reactions were incubated for 4 h at 37 °C, and products were visualized on 2% agarose gels45 (link). All gRNAs successfully digested target DNA, and a single gRNA was selected for each gene target for further experiments (Supplementary Table 5 ).
7
Quantitative Analysis of Lipid Transfer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Specific gRNAs were designed using CRISPR design tool (Synthego). Specific primers were designed using SnapGene software. The Sanger sequence results were analyzed using SnapGene and Chromas software. The levels of MTP and actin transcripts were calculated using 2−ΔΔCt method. The percentage transfer (%T) of TAG was calculated as previously described (29 (link), 30 (link)) using the formula [%T = (Fs − Fb)/(Ft − Fb) × 100], where Fs is the fluorescence of the test sample, Fb is the fluorescence of the blank, and Ft is total fluorescence. All graphing and statistical analyses were performed in GraphPad Prism software, versions 8 and 9. All data are presented as mean ± SD. The symbols ∗, ∗∗, ∗∗∗, and ∗∗∗∗ represent significance at P < 0.05, P < 0.01, P < 0.001, and P < 0.0001, respectively.
8
CRISPR Design for Zebrafish Genome
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Twelve sgRNAs were designed using the CRISPR design tool from Synthego (https://design.synthego.com/ ) using Danio rerio (GRCz11) genome and selecting top rank sgRNAs with high activity and minimal off targets [59 (link)] (Supplementary Table 2). Negative Control, Scrambled sgRNA #1, GCACUACCAGAGCUAACUCA (Synthego) was used as a negative control in pilot experiments.
9
CRISPR-Cas9 Ribonucleoprotein Delivery in Hematopoietic Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
sgRNAs were designed using CRISPR Design Tool (Synthego) and CRISPR-Cas9 guide RNA design checker (IDT), and the efficient gRNAs with least off-target sites were selected. List of gRNA used in the study is mentioned in Table S2 . For nucleofection of HUDEP-2 cell lines, 100 pmol of Cas9 (Takara) was incubated at room temperature for 10 min with 200 pmol of sgRNA (Synthego). For dual sgRNA gene editing, 100 pmol of Cas9 RNP with cut site A sgRNA and 100 pmol of Cas9 RNP with cut site B sgRNA were nucleofected (Lonza 4D nucleofector) with CA137 pulse code. For electroporation of CD34+ve HSPCs, 50 pmol of Cas9 RNP with sgRNA against PRR and 50 pmol of Cas9 RNP with sgRNA against βE1 were used; 2 × 105 cells were electroporated using P3 primary cell solution and supplement and were electroporated using Lonza 4D nucleofector with DZ100 pulse code.
For nucleofection of SCD and β-thalassemia patient HSPCs, 100 pmol of Cas9 (Takara) was incubated at room temperature for 10 min with 200 pmol of sgRNA (Synthego). For dual sgRNA gene editing 100 pmol of Cas9 RNP with cut site A sgRNA and 100 pmol of Cas9 RNP with cut site B sgRNA were nucleofected (Lonza 4D nucleofector) with DZ100 pulse code.
For nucleofection of SCD and β-thalassemia patient HSPCs, 100 pmol of Cas9 (Takara) was incubated at room temperature for 10 min with 200 pmol of sgRNA (Synthego). For dual sgRNA gene editing 100 pmol of Cas9 RNP with cut site A sgRNA and 100 pmol of Cas9 RNP with cut site B sgRNA were nucleofected (Lonza 4D nucleofector) with DZ100 pulse code.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!