Genome analyzer gaiix

Six S. Typhimurium strains collected in Belarus (S. Typhimurium 1093 and S. Typhimurium 133, isolated from stools) [33] (link), China (S. Typhimurium 2006–130 and S. Typhimurium 2007–024, from stools) [34] (link), and Nepal (S. Typhimurium B1 and S. Typhimurium D12, from water) [35] (link) (Table 1) harbouring the gene st313-td, were sequenced by Illumina GAIIx genome analyzer (Illumina, Inc., San Diego, CA). The raw reads were subsequently submitted to the European Nucleotide Archive (www.ebi.ac.uk/ena/) under accession no. ERP004195. The raw reads can be accessed freely from the following link; http://www.ebi.ac.uk/ena/data/view/PRJEB4869. Assembly was performed by using the pipeline available on the Center for Genomic Epidemiology (www.genomicepidemiology.org). The latter is based on Velvet; algorithms for de novo short reads assembly [36] (link).
MultiLocus Sequence Typing (MLST) was performed on the six isolates according to MLST Databases: http://mlst.ucc.ie/.
SNPs were identified as previously described [12] using the S. Typhimurium ST313 D23580 genome as a reference. A SNP tree showing the divergence/relatedness of the Salmonella Typhimurium strains carrying st313-td, assigned to different ST types is shown in Figure S1.

FFPE tissue blocks were cut as 8-μm sections and tumour-enriched regions were recovered by macrodissection based on regions marked on an adjacent haematoxylin-and-eosin-stained section by the study pathologist. DNA was extracted using the QIAamp DNA FFPE Tissue Kit (Qiagen) and quantified using a Qubit 2.0 Fluorometer (Invitrogen). Coding sequences of the TP53 gene (exons 2–11) were PCR-amplified from FFPE DNA using primers and conditions as described previously [34 (link)] and sequenced using an ABI 3730 DNA Analyzer (Applied Biosystems), except that an additional forward instead of reverse primer (5′-CAGGTCTCCCCAAGGCGCAC-3′) was used for the sequencing of exon 7. Mutational analysis was performed using Mutation Surveyor software version 3.97 (SoftGenetics), and sequence data were aligned to TP53 reference sequence NC_000017.10. In patients 127 and 200, mutations were identified in FFPE DNA by TAm-Seq (tagged-amplicon deep sequencing) using the 48.48 Access Array System (Fluidigm) and GAIIx Genome Analyzer (Illumina), as previously described [21 (link)].

Cells were lysed in 10-fold TRIzol reagent (w/v), phases were separated by the addition of 0.2× volume of chloroform, and the aqueous phase was combined with an equal volume of 70% ethanol and applied to a RNeasy Micro column (Qiagen) and processed as per the manufacturer’s instructions. Paired-end sequencing libraries were prepared using 1 μg of purified RNA following the mRNA-seq Sample Prep Kit according to the manufacturer’s instructions (Illumina). RNA-seq libraries were sequenced on two lanes each of an Illumina GAIIx Genome Analyzer to a minimum depth of 49 million reads. Sequence reads were aligned to the mm9 genome using the TopHat software (https://ccb.jhu.edu/software/tophat/index.shtml). Quantified fragments per kilobase of transcript per million mapped read (FPKM) values were generated using the Cufflinks software (http://cole-trapnell-lab.github.io/cufflinks/). The UCSC KnownGenes gene models were used for guided alignment and quantification.

Small RNAs (sRNAs) were extracted from Jurkat cells using a mirVana miRNA Isolation Kit (Ambion) according to the manufacturer’s protocols. An additional selection of the entire sRNA fraction between 15–30 nt was performed by isolation from 15% denaturing PAGE and subsequent ethanol precipitation. sRNA sequencing libraries were prepared using Illumina TruSeq small RNA library preparation kit (Illumina) following the manufacturer’s instructions. In brief, 0.3-0.5 μg of sRNA fraction was ligated sequentially at the 3′ and 5′ end with synthetic RNA adapter, reverse transcribed and enriched in PCR with Illumina sequencing primers with barcodes. All libraries before the enrichment PCR were normalized by using qPCR with SYBR Green and with primers identical to Illumina TruSeq PCR primers but without end modifications. The number of cycles of subsequent enrichment PCR was determined based on the threshold cycle and was one cycle less than the threshold cycle. The amplified libraries were subsequently purified by 10% PAGE according to the expected product size. To validate the library efficiency and quantification, qPCR was carried out with SYBR Green Assays according to Illumina qPCR Library quantification protocol (Illumina). Normalized small RNA libraries were sequenced for 36 cycles, of three in a separate lane, using Illumina GAIIx Genome Analyzer (Illumina).

Total RNA from control and endo453-transfected cells was extracted using TRIzol (Invitrogen). Low MW small RNA was enriched by adding 50% PEG-8000 and 5M NaCl to a final concentration of 5% and 0.5M, respectively, followed by gel purification in a 15% urea-PAGE gel (Invitrogen). Small RNAs ranging from 18-30 nt were gel purified and ligated to 3' adaptor and 5' adaptor oligonucleotides as described in the Illumina Small RNA Kit. Briefly, the 3'-RNA adaptor (5'/5rApp/ATCTCGTATGCCGTCTTCTGCTTG/3ddc/), which specifically ligates to RNAs that contain a hydroxyl group at their 3'end, was ligated to 1 μg of low MW small RNAs using T4 RNA ligase (NEB). The resulting products were subsequently ligated to the 5'-RNA adaptor (5'-GUUCAGAGUUCUACAGUCCGACGAUC-3'). cDNA was synthesized with SuperScript II Reverse Transcriptase (Invitrogen) and subjected to 12 cycles of PCR amplification with high-fidelity Phusion Polymerase (NEB) using primers as published by Illumina. Each library was loaded on a single Illumina lane at 20 pM and underwent 36 cycles of sequencing on an Illumina GAIIx Genome Analyzer.

Whole-genome sequencing of Bp82 laboratory strains and clinical isolates was performed by paired-end sequencing using an Illumina GAIIx Genome Analyzer (Illumina, Inc., San Diego, CA) and a Kapa Biosystems library preparation kit (Woburn, MA; catalog number KK8201) protocol with an 8-bp index modification. Details of library preparation, sequencing, and data analysis are provided in Text S1. For single nucleotide polymorphism (SNP) analysis, the sequence read data were aligned to the B. pseudomallei 1026b reference genome (NC_017831.1 and NC_017832.1) or B. pseudomallei K96243 (NC_006350.1 and NC_006351.1). SNP positions identified were required to have >10× coverage depth and >90% variant base calls.