Total RNA of cells (6–48-h exhaust extract/EGCG exposure of the overnight culture of 3 × 105 cells/well in a 6-well plate) was isolated using TRIzol reagent according to the manufacturer’s protocol (Invitrogen Co., CA, USA). RNA samples (2 μg) were subjected to reverse transcription (RT) at 42 °C for 1 h and then at 70 °C for 5 min, using genetically modified M-MuLV reverse transcriptase from the RevertAidTM First Strand cDNA Synthesis kit (Fermantas Inc., MD, USA). Quantitative real-time PCR analysis was then performed using primer sets (Suppl. Table 4 ) and SYBR Green (Roche Molecular Biochemicals, Mannheim, Germany). The amplification products were analyzed using a LightCycler 480 II/96 (Roche Diagnostics Ltd., Rotkreuz, Switzerland). The amplification conditions were as follows: 2-min pre-incubation at 95 °C followed by 45 cycles of 5 s at 95 °C, 10 s at 60 °C, and 15 s at 72 °C. The quantity of target cDNA in each sample was determined using the fractional PCR threshold cycle number (Ct value). Relative mRNA expression levels were normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression and the target cDNA was calculated using 2−(Ct(target) –Ct(GAPDH)).
Lightcycler 480 2 96
Manufactured by Roche
Sourced in Switzerland
The LightCycler 480 II/96 is a real-time PCR instrument designed for quantitative gene expression analysis and genotyping. It provides accurate and reliable results through its thermal block technology and advanced optics system. The instrument is suitable for a wide range of applications in life science research and diagnostics.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Sybr green, by Roche (1 mentions)
Sybr qpcr mix, by Aidlab (1 mentions)
Reverse transcription kit, by Takara Bio (1 mentions)
Sybr premix dimereraser kit, by Takara Bio (1 mentions)
Prism 6, by GraphPad (1 mentions)
M5 sprint qpcr rt kit with gdna remover, by Mei5 Biotechnology (1 mentions)
Reverse transcription system, by Takara Bio (1 mentions)
Tb green qpcr mix, by Takara Bio (1 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Lightcycler 480 sybr green 1 master mix, by Roche (1 mentions)
Reverse transcriptase kit, by Takara Bio (1 mentions)
Minibest universal rna extraction kit, by Takara Bio (1 mentions)
Sybr green supermix, by Bio-Rad (1 mentions)
Unicel dxi 800, by Beckman Coulter (1 mentions)
Primescript 2 1st strand cdna synthesis kit, by Takara Bio (1 mentions)
Trizol reagent, by Takara Bio (1 mentions)
Sybr green pcr kit, by Takara Bio (1 mentions)
Gene expression assay, by Thermo Fisher Scientific (1 mentions)
12 protocols using lightcycler 480 2 96
1
Quantitative Real-Time PCR of Cells Exposed to Exhaust Extract or EGCG
2
Quantifying Sex-Related Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Relative quantitative real-time PCR was used to detect the transcription of sex-related genes. The primers for genes used in this study were shown in Table 1. Elongation factor 1α (ef1α) was used as the reference gene. The speci city of each pair of primers was veri ed via the only peak of the melting curve. PCR reactions (20 µL) contained 1 µL of cDNA diluted ve times, 0.5 µL of 10 mM of each primer, and 10 µL of 2 × SYBR qPCR Mix (Aidlab Biotechnologies Co., Ltd., Beijing, China). Ampli cation of these genes was: pre-heating at 95 °C for 3 min, followed by 40 cycles of 95 °C for 30 s, 53 °C for 30 s, and a nal extension step at 72 °C for 30 s. The samples were analyzed in triplicate in a Light Cycler 480II/96 (Roche Diagnostics International Ltd, Switzerland). Negative control was included in each assay without cDNA.
The mRNA transcription level of each gene was calculated by the 2 -△△Ct method [37] .
The mRNA transcription level of each gene was calculated by the 2 -△△Ct method [37] .
3
Quantitative Real-Time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Use Reverse Transcription Kit (Takara, Japan) to convert RNA to cDNA according to the instructions. Using SYBR Premix Dimer Eraser Kit (Takara, Japan) to configure the experimental system, q-PCR amplification was carried out on the LightCycler@480II/96 (Roche) instrument, and the primer sequence was attached to Supplementary Table 1 . The internal control used in the qPCR experiment was GAPDH. The operation procedure of the instrument is as follows: pre-denaturation, 1 cycle, 95°C, 30S, 20°C/S. PCR amplification, 40 cycles, 95°C, 5S, 20°C/S; 55°C, 30S, 20°C/S; 72°C, 30S, 20°C/S. Dissolution curve analysis, 95°C 0S, 20°C/S; 65°C, 15S, 20°C/S; 95°C, 0S, 0.1°C/S. After getting the Ct value at the end of the program, Graph Pad Prism6 is used to analyze the experimental results.
4
Fungal Transcriptome Analysis by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The wild type and transformed strains were cultured in PDB without hygromycin B at 26 °C for 144 h. RNA was isolated from the strains using an M5 Plant RNeasy Mini Kit (Mei5 Biotechnology, Beijing, China). An M5 Sprint qPCR RT Kit with gDNA remover (Mei5 Biotechnology) was used to synthesise first-strand cDNA. qRT-PCR was performed using a Light Cycler 480II/96 (F. Hoffmann-La Roche, Basel, Switzerland).
5
Quantification of BCL-2 and MCL-1 Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Trizol reagent (Invitrogen, Carlsbad, CA, USA) was used to extract total RNA from cell lines, cDNA synthesis was performed using the Reverse Transcription System (Takara, Japan). TB Green qPCR Mix (Takara, Japan) was used to perform real-time PCR. Reactions were performed on a LightCycler®480 II/96 (Roche Diagnostics Ltd, Rotkreuz, Switzerland). The relative expression of target genes was normalized to β-Actin and calculated using the 2-ΔΔCt method. All real-time PCR reactions were performed in triplicate. The primer sequence was as follows:
Human-β-actin-F 5′ CATGTACGTTGCTATCCAGGC 3′,
Human-β-actin-R 5′ CTCCTTAATGTCACGCACGAT 3′,
Human-BCL-2-F 5′ GGTGGGGTCATGTGTGTGG 3′,
Human-BCL-2-R 5′ CGGTTCAGGTACTCAGTCATCC 3′,
Human-MCL-1-F 5′ GTGCCTTTGTGGCTAAACACT 3′; and,
Human-MCL-1-R 5′ AGTCCCGTTTTGTCCTTACGA 3′.
6
Quantification of HIV-1 Transcripts by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
LC5-RIC cells were plated, treated with compounds and inoculated with virus as described for Alu-PCR above. Cells were then harvested and RNA was extracted using the RNeasy Mini Kit (QIAGEN), according to the manufacturer’s protocol. For cDNA synthesis, 1 µg of total RNA was reverse transcribed by SuperScript II reverse transcriptase (Invitrogen) according to manufacturer’s recommendations. qRT-PCR was performed with the Roche Light Cycler® 480II 96 (Version 1.5.0.39), using LightCycler® 480 SYBR Green I Mastermix (Roche). Quantitative PCR for HIV-1 transcripts was performed with primers specific for unspliced, singly spliced or multiply spliced HIV-1 transcripts as well as for ‘all HIV transcripts’; RNA Polymerase II transcripts were analysed as internal reference gene. Primer sequences are given in Supplementary Methods and binding sites shown in Supplementary Fig. S3 . Data was analysed with the second derivative maximum method. The relative amount of HIV-1 transcripts in treated versus untreated samples was calculated by the 2(−ΔΔCt) method47 (link), using RNA polymerase II as reference gene.
7
Comparing HvAACT1 Expression in Barley
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To compare the HvAACT1 expression level in XZ29, Golden Promise and Dayton, four-day-old seedlings were exposed to 1 mM aerated CaCl2 solution containing 5 μM Al at pH 4.5 for 6 h. Two root segments (0–1 cm and 1–2 cm from tips) were sampled and frozen immediately in liquid nitrogen, then stored at − 80 °C before use. RNA was extracted by MiniBEST Universal RNA Extraction Kit (TaKaRa, Japan) according to instructions from manufacture. First strand cDNA was synthesized using Reverse Transcriptase Kit (TaKaRa, Japan). The qRT-PCR reaction consisting of SYBR Green Supermix (Bio-Rad, America) was conducted on real-time PCR System (LightCycler 480®II,96, Roche, Switzerland). Primers of HvAACT1 (5’-GTTCGCCAAGAACGATCACA-3′ and 5’-AGAGACCAAGCACCACCGTC-3′) were taken from fujii et al. [23 (link)]. Actin was used as an internal control by the ΔΔCt method and primers used for Actin were 5’-GACTCTGGTGATGGTGTCAGC-3′ and 5’-GGCTGGAAGAGGACCTCAGG-3′ taken from Furukawa et al. [8 (link)]. Expression data of HvAACT1 were normalized with those in the 1–2 cm root tips of Golden Promise.
8
Metabolic Profiles and Thyroid Status
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A complete medical history and physical examination were undertaken. Current weight, height, and waist circumstance (WC) were all measured wearing minimal clothing and without socks. Serum alanine aminotransferase (ALT), aspartate aminotransferase (AST), fasting plasma glucose, total cholesterol (TC), triglyceride (TG), high-density lipoprotein (HDL), and low-density lipoprotein (LDL) were measured by a Hitachi 7600-110 automatic analyzers (Hitachi Co, Tokyo, Japan). Serum hepatitis B virus-DNA (HBV-DNA) was measured by quantitative polymerase chain reaction (light Cycler480 II/96; Roche, Rotkreuz, Switzerland). Serum HBV-DNA level >105 copies/mL was defined as positive serum HBV-DNA. Thyroid function was detected by immunoassay system (UniCel DxI 800; Beckman Coulter, Brea, CA). The diagnosis of subclinical hypothyroidism (SCH) was established based on the serum thyroid-stimulating hormone (TSH) level over 4.2 mIU/L and normal free thyroxine (FT4) level. Euthyroidism was established based on the normal TSH, FT4, and free triiodothyronine (FT3) level (0.27–4.2 mIU/L for TSH, 12–22 pmol/L for FT4, 3.1–6.8 pmol/L for FT3).
9
Bone Tissue Analysis of Implant Integration
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
5, 10, 15, 20 days after insertion, 1 mm femur tissues around implants were prepared for qRT-PCR. Total RNA of these bone tissues was isolated using Trizol reagent (TaKaRa, China) according to the manufacture’s instruction. The first-strand cDNA was synthesized from 1 μg of total RNA using PrimeScript™ II 1st Strand cDNA Synthesis Kit (Takara, Dalian, China). Quantitative reverse-transcription polymerase chain reaction (qRT-PCR) was conducted with a standard SYBR Green PCR kit (TaKaRa, China) on the LightCycler 480II96 (Roche, Switzerland). The relative expressions of miR-29a-3p, and mRNA level expression of ALP, Runx2 were measured using the 2−ΔΔCt methods with GAPDH as an internal control. Primer sequences are listed in Table 1 .
Primers used for qRT-PCR
| Gene | Forward primer sequence (5′–3′) | Reverse primer sequence (5′–3′) |
|---|---|---|
| ALP | TGAGCGACACGGACAAGAAG | GCCTGGTAGTTGTTGTGAGCAT |
| Runx2 | CACAAGTGCGGTGCAAACTT | AATGACTCGGTTGGTCTCGG |
| Dvl2 | TCCACCATTACCCCCTTTGC | GCCATGCTCACTGCTGTCT |
| Fzd4 | GGAAGGACCAGGTGACGAAG | GGAATATGATGGGGCGCTCA |
| GAPDH | TGATGGGTGTGAACCACGAG | CTGATGGGTGTGAACCACGAG |
| miR-29a-3p | UAACCGAUUUCAAAUGGUGCUA | |
10
Quantifying GABA Expression in Rat Brain
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The gene expression of GABA in brain tissue was determined according to the method described in [45 (link)]. Total RNA was purified from the rat brain tissue using the RNAeasy® Lipid Tissue Mini Kit (Qiagen, Germany) (Cat No. 74104). To prepare complementary DNA (cDNA), purified total RNA from each sample was reverse-transcribed by random hexamers of the high-capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City, CA, USA). GABAergic expression was estimated by quantitative RT-PCR (Light Cycler 480 II/96, Roche Applied Science, Basel, Basel-Stadt, Switzerland) using an iTaq™ Universal SYBR® Green Super mix kit prepared according to the manufacturer’s protocol Gene Expression Assay (Assay ID Rn00691548_m1, Applied Biosystems). Gene expressions of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were used as a reference gene (assay ID Rn01775763g1, Applied Biosystems). Specific primers were added to the reaction mix at a final concentration of 10 pM.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!