Psicheck2 dual luciferase vector

PsiCHECK2 dual luciferase vector (Promega) was used to confirm the function of the putative miR-342-3p binding sites in the Bcl2l1 3′ UTR. For luciferase reporter assays, 320 bp (miR-342-3p_1) and 309 bp (miR-342-3p_2) of the 3′ UTR of the Bcl2l1 gene, including the mir-342-3p target sites, were amplified by PCR using F1/R1 and F3/R3 primer pairs with XhoI and NotI sites. PCR was performed on mouse macrophage-derived genomic DNA. The XhoI/NotI-digested PCR product was cloned into the XhoI/NotI-digested PsiCHECK2 dual luciferase vector. F1/R2 and F2/R1 as well as F3/R4 and F4/R3 primers were used to delete the mir-342-3p target sites from the 3′ UTR. After mixing the two PCR products and digestion with XhoI and NotI, the 3′ UTR fragment with deleted mir-342-3p binding sites was cloned into a XhoI/NotI-digested psiCHECK2 vector. Primer sequences are given in Additional file 2.

For the luciferase assay, we cloned the TAF9B 3’-UTR (WT) downstream of the Renilla luciferase gene in the psiCHECK2 dual-luciferase vector (Promega) (for primers, see S3 Table). The Firefly luciferase gene (which is expressed from the same vector from an HSV-TK promoter) was used as an internal reference. For the mutated TAF9B 3’-UTR (MUT) construct, a 24 bp mutation was introduced at the proposed sno-miR-28 binding site (CTTTCAGAATTGTAAAATGCTATA to GAATTCAAAAAAAAAAAAAAAAAA) (Fig 3D, left panel) (for primers, see S3 Table). Approximately 1 × 10⁵ H1299 cells/well in 24-well plates. After 24 hours, in each well we co-transfected 0.4 ng/μL of either WT or MUT luciferase constructs with 8.33 nM of either sno-miR-28 mimics (Genepharma) or negative control RNA (ncRNA) (Genepharma), using Lipofectamine 2000 (Invitrogen) following the manufacturer’s instructions. Cells were harvested 72 hours post-transfection, and Renilla and Firefly luminescence were measured by a GloMax 20/20 Luminometer (Promega) following the manufacturer’s instructions. A ratio of Renilla/Firefly luminescence intensity was used to indicate the relative luciferase expression activity.

A series of constructs containing TIF1γ 3’-UTR and circPTK2 exon11 were generated using psiCHECK2 dual luciferase vector (Promega, Madison, WI, USA). Different fragments (Additional file 4: Table S2) were directly synthesized (GENEWIZ Inc., Suzhou, China), subcloned into the psiCHECK-2 vector to create various constructs. Each construct was subsequently cotransfected with miR-429 mimic (5’-UAAUACUGUCUGGUAAAACCGU-3′) or miR-200b-3p mimic (5’-UAAUACUGCCUGGUAAUGAUGA-3′) and a negative control (miR-NC, 5’-UUCUCCGAACGUGUCACGUTT-3′) into A549 and H226 cells. All the transient transfections, including miR-429 inhibitor (5’-ACGGUUUUACCAGACAGUAUUA-3′) or miR-200b-3p inhibitor (5’-UCAUCAUUACCAGGCAGUAUUA-3′) and anti-miR-NC (5’-CAGUACUUUUGUGUAGUACAA-3′), were performed using Lipofectamine 2000 (Invitrogen). After 48 h, cells were harvested, and luciferase activities were determined by the Dual-Luciferase Reporter Assay Kit (Promega). Results are presented as relative Renilla luciferase activities, which are normalized to firefly luciferase activities. Each experiment was performed in triplicate.