β actin

Total RNA was isolated from HEK293 WT, HEK293 UBXN7(−/−) and HEK293 MUL1(−/−) cells using the RNAeasy Mini Kit (Qiagen). First-strand cDNA was generated using the QuantiTect Reverse Transcription Kit according to the manufacturer’s protocol (Qiagen). Briefly, 500 ng of RNA was reverse transcribed in a 20 μl volume and after heat-inactivation diluted with 80 μl of water. For the qRT-PCR, 2 μl of the diluted RT reaction was used in a final volume of 10 μl. qRT-PCR was carried out with the Rotor-Gene SYBR Green PCR Kit using the following QuantiTect primers: EIF3D and β-actin (Qiagen). The HIF-1α primers used were: 5’-GATACCAACAGTAACCAACCT-Forward, 5’-CTCTTTTGGCAAGCATCCTG-Reverse and the NRF2 primers were: 5’-CCAGCAGGACATGGATTTGA-Forward, 5’-TTGGGAATGTGGGCAACCTG-Reverse. The qPCR reactions were run in a Rotor-Gene Q instrument for 40 cycles (95°C for 7 seconds, 60°C for 20 seconds and 72°C for 10 seconds) after an initial denaturation step of 5 minutes. All reactions were performed in triplicates. Cycle threshold (Ct) values were obtained using a fixed threshold setting and values were normalized with the EIF3D Ct data. Data were analyzed with the 2−ΔΔCt Livak method to determine changes in gene expression, while β-actin served as a control.

Total RNA was purified from brain cortical area of female mice by Direct-zol RNA miniprep (Zymo Research), eluted in nuclease-free water (Ambion) and stored at −80°C. Reverse transcription was performed using SuperScript III First-Strand Synthesis System (Life Technologies). Real-time PCR was conducted with Universal SYBR Green Supermix (Bio-Rad) using an iCycler thermocycler (Bio-Rad) to detect levels of the corresponding Sirt3 (NAD-dependent deacetylase sirtuin-3, mitochondrial), mitochondrial transcription factor A (TFAM) and β-actin (Qiagen). The following primers were used: Sirt3 forward primer, GAGCGGCCTCTACAGCAA, and reverse primer, GGAAGTAGTGAGTGACATTGGG. TFAM forward primer, AACACCCAGATGCAAAACTTTCA, and reverse primer, GACTTGGAGTTAGCTGCTCTTT. β-actin forward primer, AGTGTGACGTTGACATCCGTA, and reverse primer, GCCAGAGCAGTAATCTCCTTC (Integrated DNA technologies). The relative levels of expression were quantified and analyzed by Bio-Rad iCycler iQ software (Bio-Rad). Relative mRNA levels were calculated by ΔΔCt method with β-actin used as an internal control for each specific gene amplification.

Total RNA was isolated from parental A549 cells and negative control shRNA–transfected cells or human TrxR1 shRNA-transfected cells using an RNeasy Mini Kit (Qiagen) according to the manufacturer’s protocols. Following quantitation, 400 ng of total RNA was subjected to reverse transcription using RT² First Strand Kit (Qiagen) according to the manufacturer’s protocol. qPCR was performed on an Applied Biosystem ViiA 7 Real-Time PCR system (Life Technologies) with RT² SYBR Green ROX qPCR Mastermix (Qiagen) according to the manufacturer’s protocol. The primers for PCR reactions were for human Trx1, TrxR1, and β-actin (Qiagen). PCR mixtures contained 0.5 μL of primers, 0.5 μL of reverse transcription mixtures, and 5 μL of SYBR Green Mastermix in a final volume of 10 μL. PCR was run at 50 °C for 2 min and 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. Samples were analyzed in triplicate, and the data normalized to β-actin levels using the Ct method.