DRG sections (10 μm thickness) were mounted onto poly-L-lysine-coated slides and fixed in 4 % paraformaldehyde for 10 min. Slides were subsequently treated by acetic anhydride (0.25 % v/v) and proteinase K (10 μg/mL) followed by dehydration in a graded series of ethanol (70 % for 1 min, 80 % for 1 min, 95 % for 1 min x 2, 100 % for 1 min x 2) prior to hybridization in buffer containing 50 % formamide, 5xSSC, 500 ug/mL yeast tRNA, 0.1% Tween-20 (pH=6.0 adjusted by citric acid) and RNA probes. Adapted from published methods [7 (link)], the complementary RNA (cRNA, antisense) probes for fluorescence in situ hybridization (FISH) were generated by in vitro transcription using FISH Tag™ RNA Green Kit, with Alexa Fluor™ 488 dye (Thermo Fisher Scientific). The sense strain of RNA was used as negative control. The primers for PCR of cDNA of interests as templates for generating FISH RNA probes were that rat β2AR Forward GCCGAGCTCTGTCCACGTCATCCGGGCCA and Reverse CGGGGTACCGTCCTGTCAGG GAGGGGCCG; rat glutamine synthetase (GS) Forward GCCGAGCTCTGGACCCCAAGGACC CTATT and Reverse CGGGGTACCCAATCCGGGGAATGCGGATA. The cloning vector pSP73 (Promega Corporation) via restriction enzymatic sites SacI and KpnI was used for cDNA cloning and amplification, and in vitro transcription. After hybridization, the slides were visualized on a Zeiss fluorescent microscope.
Fish tag rna green kit
Manufactured by Thermo Fisher Scientific
Sourced in United States
The FISH Tag RNA Green Kit is a product designed for the fluorescent labeling of RNA molecules. It provides a simple and efficient method to incorporate fluorescent dyes into RNA samples for use in various applications, such as fluorescence in situ hybridization (FISH) and RNA detection experiments.
Automatically generated - may contain errors
Lab products found in correlation
Alexa fluor 488 dye, by Thermo Fisher Scientific (3 mentions)
Psp73, by Promega (1 mentions)
Confocal microscope, by Zeiss (1 mentions)
4 6 diamidino 2 phenylindole (dapi), by Thermo Fisher Scientific (1 mentions)
Slowfade gold antifade mountant, by Thermo Fisher Scientific (1 mentions)
Topo ta cloning, by Thermo Fisher Scientific (1 mentions)
Hoechst 33342, by Thermo Fisher Scientific (1 mentions)
Lsm 780 confocal microscope, by Zeiss (1 mentions)
6 protocols using fish tag rna green kit
1
RNA Fluorescence In Situ Hybridization Protocol
2
Subcellular Localization of lncRNA GAS5
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Online software LncATLAS (http://lncatlas.crg.eu/ ) was utilized to predict the distribution of GAS5. The subcellular localization of GAS5 was analyzed using a FISH Tag™ RNA green kit with an Alexa Fluortm 488 dye kit (ThermoFisher). The degenerated NPCs were fixed (increasing cell membrane permeability), dehydrated, and hybridized overnight at 42°C. The samples were washed, mixed with 4′,6-diamidino-2-phenylindole, sealed and observed under a confocal microscope (Carl Zeiss, Oberkochen, Germany). Scramble control probe (Scr) was used as a negative control.
3
Fluorescent In Situ Hybridization for lncRNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fluorescent in situ hybridization (FISH) was performed using a FISH Tag RNA Green Kit with Alexa Fluor 488 dye (Invitrogen). Probes targeting lncH19, lncHOXD-AS2, and miR-198 were used according to the manufacturer’s protocol.
4
RMST Expression Detection via FISH
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The FISH Tag RNA Green Kit (Invitrogen, USA) was used according to the manufacturer’s protocol. RMST detection probes were synthesized using linearized plasmids containing T7 RNA polymerase. Hybridization and washing were performed as per the manufacturer’s instructions.
5
FISH Analysis of Wnt Ligand Expression
6
Fluorescent In Situ Hybridization of TP63 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human TP63 gene sequence was amplified by PCR, and the amplicon was sub-cloned into an expression vector for probe synthesis. A specific probe against the TP63 gene was synthesized from the linearized plasmid by FISH Tag™ RNA Green Kit, with Alexa Fluor™ 488 dye (Invitrogen, CA, USA). The subsequent hybridization procedure was carried out according to the manufacturer’s instructions. Briefly, cells were rinsed, fixed, permeabilized, and subjected to proteinase K treatment. Probe hybridization was done with buffer (50% formamide, 5×SSC) for overnight at 55 °C. The hybridized sample was washed and counter-stained with Hoechst 33342 (Thermo Fisher Scientific) for nuclei. Visualization of samples was performed with ZEISS LSM780 confocal microscope.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!