The largest database of trusted experimental protocols

Pcmv sirt1 t1 flag

Manufactured by Sino Biological

PCMV-SIRT1-t1-Flag is a plasmid that contains the human SIRT1 gene under the control of a CMV promoter, with a C-terminal Flag tag. The plasmid is designed for expression of the SIRT1 protein in mammalian cell lines.

Automatically generated - may contain errors

2 protocols using pcmv sirt1 t1 flag

1

Overexpression and Knockdown of SIRT1 in HMC3 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
SIRT1 cDNA was made from pCMV-SIRT1-t1-Flag (purchased from Sino Biological) via PCR amplification. SIRT1 cDNA was cloned into the FUGW vector using Seamless Cloning Kit (Beyotime, D7010M) and confirmed by DNA sequencing. HMC3 cells were plated into 24-well or 6 cm dish at appropriate intensity and cultured overnight. We transfected 150 ng plasmid per well into 24-well or 1.5 μg plasmid per well into 6 cm dish. SIRT1 plasmid or FUGW plasmid was transfected using ViaFect reagent (Promega, #E4981) according to manufacturer's instructions. After transfection for 24 h, cells were stimulated by Aβ for 72 h. The knockdown of SIRT1 was performed by the transfection with specific siRNA (Tsingke Biotechnology Co., Ltd.) using ViaFect reagent. The cloning primers used were as follows: SIRT1 (forward: 5′-TGGGCTGCAGGTCGACTCTAGAATGGCAGATGAAGCAGCTCTC-3′ and reverse: 5′-TTG ATATCGAATTCTAGACTATGATTTGTTTGATGGATAGTTCATGTCT-3′). The siRNA primers were as follows: siSIRT1-1 (forward: 5′-CACCUGAGUUGGA UGAUAUTT-3′ and reverse: 5′-AUAUCAUCCAACUCAGGUGTT-3′) and siSIRT1-2 (forward: 5′-GUCUGUUUCAUG UGGAAUATT-3′and reverse: 5′-UAUUCCACAUGAAACAGACTT-3′).
+ Open protocol
+ Expand
2

Cloning and Knockdown of SIRT1 in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
SIRT1 cDNA was generated from pCMV-SIRT1-t1-Flag (purchased from Sino Biological) via PCR amplification and then cloned into the FuGW vector by using Seamless Cloning Kit (Beyotime, D7010M) according to the manufacturer’s instructions and confirmed by DNA sequencing. Cells were transfected with constructed SIRT1 plasmid using lipofectamine 3000 (ThermoFisher Scientific, L3000001). After transfection for 24 h, cells were stimulated by Aβ. The knockdown of SIRT1 was performed by the transfection with specific siRNA (Tsingke Biotechnology Co., Ltd.) using lipofectamine 3000.
The cloning primers were as follows:
Forward, TGGGCTGCAGGTCGACTCTAGAATGGCA GATGAAGCAGCTCTC;
Reverse, TTGATATCGAATTCTAGACTATGATTTGTTTGA TGGATAGTTCATGTCT;
The siRNA primers were as follows:
siSIRT1-1: Forward, CACCUGAGUUGGAUGAUAUTT;
siSIRT1-1: Reverse, AUAUCAUCCAACUCAGGUGTT;
siSIRT1-2: Forward, GUCUGUUUCAUGUGGAAUATT;
siSIRT1-2: Reverse, UAUUCCACAUGAAACAGACTT;
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!