Total RNA was isolated by using TRIzol reagent according to the manufacturer's protocols (Ambion, Grand Island, NY). Briefly, 25 mg of ventricular tissue was homogenized in 1 ml TRIzol on ice (Fisher Scientific, Power Gen 125, setting 5). mRNA expression was determined using a two-step reaction: 1) cDNA was made using a iScriptTM Reverse Transcription Supermix for RT-qPCR kit (Cat.# 170-8841, BIO-RAD); 2) 2 μl cDNA was amplified on a Roche Lightcycler 480II system with exon-spanning Taqman Probes (Cat.# Mm01185221_m1, MuRF1/Trim63; Cat.# Mm01292963_g1, MuRF2/Trim55; Cat.# Mm00491308_m1, MuRF3/Trim 54; and Cat.# Hs99999901_s1, 18S, Applied Biosystems, Inc.) in 2× Lightcycler 480 Master Mix (Cat.# 04 707 494 001, Roche Diagnostics, Corp., Indianapolis, IN). Each reaction was run in triplicate and relative mRNA expression was determined using 18S as internal endogenous controls using ΔΔCT analysis.
Lightcycler 480 mastermix
Manufactured by Roche
Sourced in Switzerland
The LightCycler 480 Mastermix is a reagent for real-time PCR analysis. It is designed to be used with the LightCycler 480 Instrument for the detection and quantification of DNA and RNA targets.
Automatically generated - may contain errors
Lab products found in correlation
Transcriptor first strand cdna synthesis kit, by Roche (3 mentions)
Lightcycler 480 real time pcr system, by Roche (3 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Human universal probe library, by Roche (2 mentions)
Lightcycler 480, by Roche (2 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Lightcycler480 real time qpcr machine, by Roche (2 mentions)
Powergen 125, by Thermo Fisher Scientific (1 mentions)
Lightcycler 480 2 system, by Roche (1 mentions)
Tissuelyzer, by Qiagen (1 mentions)
Lightcycler 480 system, by Roche (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Purelink viral rna dna mini kit, by Thermo Fisher Scientific (1 mentions)
Random hexamer primer, by Thermo Fisher Scientific (1 mentions)
Superscript 3, by Thermo Fisher Scientific (1 mentions)
Turbo dnase, by Thermo Fisher Scientific (1 mentions)
Snorna202, by Thermo Fisher Scientific (1 mentions)
Qiazol reagent, by Thermo Fisher Scientific (1 mentions)
Taqman rt qpcr, by Thermo Fisher Scientific (1 mentions)
High capacity cdna reverse transcriptase kit, by Thermo Fisher Scientific (1 mentions)
18 protocols using lightcycler 480 mastermix
1
Quantification of Muscle Atrophy Genes
2
Quantitative Real-time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time PCR was done using 2× LightCycler 480 Master Mix along with the appropriate probes from the Human Universal Probe library (Roche, Mannheim, Germany). Three replicates were amplified for each sample, and the expression level of a reference gene [glyceraldehyde 3-phosphate dehydrogenase (GAPDH)] was used for normalization of expression data. The data were calculated with the 2−ΔΔCT method and expressed as fold changes (Livak and Schmittgen, 2001 (link)). Detailed information about the protocols used and the primer sequences are given in the Supplementary Materials
3
Transcriptional Profiling of M. mycetomatis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from one week old M. mycetomatis cultures. Mycelium was suspended in TRIzol Reagent (Thermo Fisher) and, using metal beads, was lysed with a tissue lyzer (Qiagen). RNA was extracted using chloroform, and precipitated and washed with ethanol. The RNA pellet was air-dried and suspended in diethyl pyrocarbonate (DEPC)-treated water. Remaining DNA was removed with the Ambion DNA-free kit. cDNA was prepared using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Expression of eight genes, suspected to be highly expressed in M. mycetomatis, was measured via real-time qPCR on a LightCycler 480 (Roche, Woerden, Netherlands). Genes and corresponding primers are listed in S1 Table . Each 20 μl qPCR reaction contained 10 μl of LightCycler 480 mastermix (Roche), 0.2 μl of each primer, 1 μl SYTO82 (Roche) and 1 μl cDNA.
4
Quantitative PCR of Inflammatory Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Q-PCR was performed in duplicates using a PCR thermal cycler (LightCycler 480 System, Roche) with specific primers using LightCycler 480 Mastermix (Roche). Gene expression levels were analyzed using the ΔΔct method normalized to peptidylprolyl isomerase A (PPIA) as a housekeeping gene and laminectomy as a baseline. Primer sequences for the genes analyzed are as follows: PPIA: ATG TGC CAG GGT GGT GAC TTT A (forward primer 5′–3′); TGT GTT TGG TCC AGC ATT TGC C (reverse primer 5′–3′), CCL3: CAG CTT ATA GGA GAT GGA GCT ATG (forward primer 5′–3′); TCA CTG ACC TGG AAC TGA ATG (reverse primer 5′–3′), TNF: TTG CTC TGT GAA GGG AAT GG (forward primer 5′–3′); GGC TCT GAG GAG TAG ACA ATA AAG (reverse primer 5′–3′), IL-1β: ATG GGC AAC CAC TTA CCT ATT T (forward primer 5′–3′); GTT CTA GAG AGT GCT GCC TAA TG (reverse primer 5′–3′).
5
MERS-CoV Detection by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were lysed in RLT buffer with 40 mm DTT and extracted with the
RNeasy mini kit (Qiagen). Viral RNA in the supernatant was extracted with the
PureLink Viral RNA/DNA mini kit (Life Technologies, Inc.). Reverse transcription
(RT) and quantitative PCR (qPCR) were performed with the Transcriptor First
Strand cDNA synthesis kit and LightCycler 480 master mix from Roche Applied
Science as we previously described (34 (link)).
In the RT reactions, reverse primers against the N gene of MERS-CoV were used to
detect cDNA complementary to the positive strand of viral genomes. The following
sets of primers were used to detect N in qPCR: forward,
5′-CAAAACCTTCCCTAAGAAGGAAAAG-3′, reverse,
5′-GCTCCTTTGGAGGTTCAGACAT-3′, and probe (6-carboxyfluorescein),
5′-ACAAAAGGCACCAAAAGAAGAATCAACAGACC-3′ BHQ1.
RNeasy mini kit (Qiagen). Viral RNA in the supernatant was extracted with the
PureLink Viral RNA/DNA mini kit (Life Technologies, Inc.). Reverse transcription
(RT) and quantitative PCR (qPCR) were performed with the Transcriptor First
Strand cDNA synthesis kit and LightCycler 480 master mix from Roche Applied
Science as we previously described (34 (link)).
In the RT reactions, reverse primers against the N gene of MERS-CoV were used to
detect cDNA complementary to the positive strand of viral genomes. The following
sets of primers were used to detect N in qPCR: forward,
5′-CAAAACCTTCCCTAAGAAGGAAAAG-3′, reverse,
5′-GCTCCTTTGGAGGTTCAGACAT-3′, and probe (6-carboxyfluorescein),
5′-ACAAAAGGCACCAAAAGAAGAATCAACAGACC-3′ BHQ1.
6
Quantifying CMV Promoter Binding Factors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT-PCR was performed using the Roche LightCycler® 480 Real-Time PCR System and the LightCycler 480 Mastermix (04707494001 Roche, Indianapolis, IN). For quantification of CMV, the probe/primers combinations were as follows: forward primer: gcagagctcgtttagtgaacc; reverse primer: gaggtcaaaacagcgtggat; Universal ProbeLibrary probe: #80 (cat.no. 04689038001, Roche, Indianapolis, IN). Reaction conditions were set up according to the manufacturer’s instructions. Crossing points (Ct) were generated from the LightCycler Software. Relative quantification of the CMV promoter and GAPDH bound to the transcription factors was performed using the 2^delta delta Ct method [25 (link)]. All samples were normalized to the respective input DNA for the ChIP reaction (e.g. A0 cell line, CMV copies in input DNA) and then to sample 3 of the A0 CREB1 immunoprecipitated for CMV.
7
Quantifying Viral-Induced Interferon Response
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Following RNA transfection/viral infection, total cellular RNA was extracted via column purification (Omega Biotek) and treated with Turbo DNase (ThermoFisher) to remove DNA contamination. cDNA was reverse-transcribed from 500 ng total RNA extract with Superscript III (ThermoFisher) following manufacturer’s protocols using random hexamer primers (ThermoFisher). Following reverse-transcription RNA was degraded with 333 mM NaOH and cDNA purified via ethanol precipitation. RT-qPCR was performed using LightCycler 480 Mastermix (Roche) with the following primers: IFNB [Fwd: GCGACACTGTTCGTGTTGTC, Rev: GCCTCCCATT CAATTGCCAC] and RIG-I [Fwd: CTGATTGCCACCTCAGTTGC Rev: GTCCCATGTCTGAAGGCGTA] were normalized to ACTB [Fwd: TTCCAGCAGATGTGGATCAG Rev: GGTGTAACGCAACTAAGTCA], and further normalized to Mock-infected wells to determine fold induction of gene expression.
8
Quantifying CMV and GAPDH Transcription Factors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real time quantitative PCR was performed using the Roche
LightCycler® 480 Real-Time PCR System and the
LightCycler 480 Mastermix (04707494001 Roche, Indianapolis, IN). For
quantification of CMV, the probe/primers combinations were as follows: forward
primer: gcagagctcgtttagtgaacc; reverse primer: gaggtcaaaacagcgtggat; Universal
ProbeLibrary probe: #80 (cat.no. 04689038001, Roche, Indianapolis, IN). For
quantification of glyceraldehyde 3-phosphate dehydrogenase (GAPDH), the
probe/primers combinations were as follows: forward primer:
cgtattggacgcctggttac; reverse primer: ggcaacaacttccactttgc; Universal
ProbeLibrary probe: #8 (cat.no. 04685067001, Roche, Indianapolis, IN). Reaction
conditions were set up according to the manufacturer’s instructions.
Crossing points (Ct) were generated from the LightCycler Software. Relative
quantification of the CMV promoter and GAPDH bound to the transcription factors
was performed using the 2^delta delta Ct method (Rao et al., 2013 (link)). All samples were normalized to the respective
input DNA for the ChIP reaction (e.g. A0 cell line, CMV copies in input DNA) and
then to sample 3 of the A0 CREB1 precipitate for CMV or GAPDH, respectively.
LightCycler® 480 Real-Time PCR System and the
LightCycler 480 Mastermix (04707494001 Roche, Indianapolis, IN). For
quantification of CMV, the probe/primers combinations were as follows: forward
primer: gcagagctcgtttagtgaacc; reverse primer: gaggtcaaaacagcgtggat; Universal
ProbeLibrary probe: #80 (cat.no. 04689038001, Roche, Indianapolis, IN). For
quantification of glyceraldehyde 3-phosphate dehydrogenase (GAPDH), the
probe/primers combinations were as follows: forward primer:
cgtattggacgcctggttac; reverse primer: ggcaacaacttccactttgc; Universal
ProbeLibrary probe: #8 (cat.no. 04685067001, Roche, Indianapolis, IN). Reaction
conditions were set up according to the manufacturer’s instructions.
Crossing points (Ct) were generated from the LightCycler Software. Relative
quantification of the CMV promoter and GAPDH bound to the transcription factors
was performed using the 2^delta delta Ct method (Rao et al., 2013 (link)). All samples were normalized to the respective
input DNA for the ChIP reaction (e.g. A0 cell line, CMV copies in input DNA) and
then to sample 3 of the A0 CREB1 precipitate for CMV or GAPDH, respectively.
9
Quantifying CMV and GAPDH Transcription Factors
10
Quantification of miRNA and mRNA
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!