RNA was extracted using the RiboPure Yeast RNA Purification Kit (Thermo Fisher Scientific, catalog# AM1926). cDNA was synthesized using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, catalog# 4368814). Expression levels of YWP1 and HWP1 were measured in the WT, ume6 Δ/Δ and hda1 Δ/Δ strain backgrounds by real-time quantitative PCR (qPCR) with the following primer pairs: CJNO3815 (5’ ACAAATGTCAAGAAACCACCGT 3’) and CJNO3816 (5’ ATCGCAAGCAACAACAGTGATA 3’) for YWP1; CJNO3813 (5’ GGTCAAGGTGAAACAGAGGAAG 3’) and CJNO3814 (5’ AATCACAAGGTTCTTCCTGCTG 3’) for HWP1. Expression levels were assessed under the filamentation assay conditions described above. Normalized relative gene expression values were calculated by the ΔΔCT method using ADE2 as a reference gene and normalized with respect to the WT strain. Results are the means of two determinations.
Ribopure yeast rna purification kit
Manufactured by Thermo Fisher Scientific
Sourced in United States
The RiboPure Yeast RNA Purification Kit is a laboratory tool designed to isolate and purify total RNA from yeast cells. The kit utilizes a silica-based membrane technology to capture and extract RNA molecules, providing a reliable and efficient method for RNA isolation.
Automatically generated - may contain errors
Lab products found in correlation
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Potato dextrose agar (pda), by Merck Group (1 mentions)
Potato dextrose broth (pdb), by Merck Group (1 mentions)
Quick dna fungal bacterial miniprep kit, by Zymo Research (1 mentions)
Superscript 3 first strand synthesis system, by Thermo Fisher Scientific (1 mentions)
100 g genomic tips, by Qiagen (1 mentions)
Qiaprep miniprep kit, by Qiagen (1 mentions)
0.5 mm glass bead, by Biospec (1 mentions)
Mini beadbeater 16, by Biospec (1 mentions)
5 protocols using ribopure yeast rna purification kit
1
qPCR analysis of filamentation genes
2
Genomic and Transcriptomic Analysis of Streptomyces araneosene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
S. araneosene NRRL 3196 was obtained from the Agricultural Research Service Culture Collection (NRRL) and maintained on potato dextrose agar (Sigma). A 10 mL liquid culture of S. araneosene NRRL 3196 in potato dextrose broth (Sigma) was shaken for 7 days at 28 °C and 250 rpm. The cell body was then collected for genomic DNA extraction with Quick-DNA™ Fungal/Bacterial Miniprep Kit (Zymo research) following the manufacturer’s protocol.
For mRNA extraction and cDNA synthesis, a 10 mL liquid culture of S. araneosene in production medium (10% glucose, 1.5% polypeptone, 1.0% corn steep liquor, 0.5% yeast extract, 0.2% L-tryptophan, 0.5% K2HPO4, 0.4% FeSO4 · 7H2O, 0.05% CoSO4, 0.1% MgSO4 · 7H2O) was shaken for 10 days at 28 °C and 250 rpm27 (link). The cell body was then collected for mRNA extraction with RiboPure™ Yeast RNA Purification Kit (Thermofisher) following the manufacturer’s protocol. First strand synthesis was performed with SuperScript™ III First-Strand Synthesis System (Invitrogen).
For mRNA extraction and cDNA synthesis, a 10 mL liquid culture of S. araneosene in production medium (10% glucose, 1.5% polypeptone, 1.0% corn steep liquor, 0.5% yeast extract, 0.2% L-tryptophan, 0.5% K2HPO4, 0.4% FeSO4 · 7H2O, 0.05% CoSO4, 0.1% MgSO4 · 7H2O) was shaken for 10 days at 28 °C and 250 rpm27 (link). The cell body was then collected for mRNA extraction with RiboPure™ Yeast RNA Purification Kit (Thermofisher) following the manufacturer’s protocol. First strand synthesis was performed with SuperScript™ III First-Strand Synthesis System (Invitrogen).
3
Isolation and Purification of Nucleic Acids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was isolated from BC01-12 using QIAGEN genomic tips 100/G for Oxford Nanopore Sequencing using wide-bore tips. During cloning all plasmids were isolated from bacteria using QIAGEN QIAprep Miniprep kits. For qPCR, RNA was isolated using RiboPure Yeast RNA purification kit (Thermo Scientific) from 50 ml shaking cultures in the mid-log phase (250 ml baffled flasks, 30 °C, 180 r.p.m.).
4
RNA Extraction and Purification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After incubation for germination, cells were collected with centrifugation at 5°C, washed with cold PBS and had RNA extracted simultaneously with T0 min cells. Total RNA isolation was done by using the components and the protocol of the RiboPure Yeast RNA Purification Kit (Life technologies). This included cell disruption with RNAse-free zirconium beads in the presence of RNAse inhibiting lysis solution and column purification. The isolated RNA was treated with RNAse-free DNAse I. To insure that another mode of isolation gave us similar results as the kit, RNA was extracted simultaneously once, using the hot acid phenol isolation protocol [11 ]. RNA quantification was done on total freshly isolated RNA, always diluted in the same volume of 50 μL, using a Qubit 2.0 fluorometer. To see if any polyadenylated rRNAs are involved, we did a one time poly-A selection at times T0 T30 T60 utilizing the BcMag Quick mRNA Purification Kit (Bioclone Inc.) according to the manufacturer’s directions.
5
Yeast DNA and RNA Extraction Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Yeast DNA from X. dendrorhous and S. cerevisiae was obtained by mechanical cell rupture in 600 μl of TE buffer (25 mM Tris-HCl, 10 mM EDTA, pH 8.0) and 100 μl of 0.5-mm glass beads (BioSpec Products Inc., Bartlesville, OK, USA) using a Mini-beadbeater-16 (BioSpec Products Inc., Bartlesville, OK, USA) for 1 min, followed by centrifugation for 5 min at 4,000 x g to recover the aqueous phase. DNA was extracted by adding 1 volume of a phenol:chloroform:isoamilic alcohol mixture (25: 24: 1, v/v/v), vortexing and centrifuging for 1 min at 20,000 x g. The aqueous phase was recovered and washed with 1 volume of chloroform:isoamilic alcohol (24: 1, v/v) to remove traces of phenol. DNA was precipitated with 1 ml of cold absolute ethanol and incubated at −20 °C for 1 h. Then, it was centrifuged for 10 min at 20,000 x g, and the supernatant was eliminated. The pellet was allowed to dry at 37 °C for 5 min and then suspended in 50 μl of water.
Total RNA was extracted from 2 to 5 ml of X. dendrorhous liquid cultures. Cells were harvested by centrifugation, and RNA was obtained using a RiboPure Yeast RNA purification kit (Life Technologies, Carlsbad, CA, USA).
Total RNA was extracted from 2 to 5 ml of X. dendrorhous liquid cultures. Cells were harvested by centrifugation, and RNA was obtained using a RiboPure Yeast RNA purification kit (Life Technologies, Carlsbad, CA, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!