Bigdye terminator cycle sequencing ready reaction kit version 3

Column purification of amplicons was performed with QIAquick PCR purification kits (Qiagen, Hilden, Germany). BigDye terminator cycle sequencing ready reaction kit version 3.1 (Applied Biosystems, Carlsbad CA, USA) was used for Sanger sequencing utilising four primers; HIV+4141 (5' TCT ACC TGG CAT GGG TAC CA 3' nucleotide positions relative to HXB2 4141–4160), INFORI (5' GGA ATC ATT CAA GCA CAA CCA GA 3' nucleotide positions relative to HXB2 4059–4081), INREVII (5' CCT AGT GGG ATG TGT ACT TCT GA 3' nucleotide positions relative to HXB2 5197–5219 and IN4764AS (5' CCATTTGTACTGCTGTCTTAA 3’ nucleotide positions relative to HXB2 4764–4744).
The cycle sequencing reaction mix contained 3.8 μL of dH₂0, 3 μL of Big Dye 5X sequencing buffer, 1 μL Big Dye terminator, 0.2 μL of 10 μM of each sequencing primer and 2 μL of the purified DNA template to make a total reaction volume of 10 μL. Cycle sequencing parameters were the same as for those used for the VS-Int assay.
Purification of cycle sequencing products was done using ZR-96 DNA sequencing clean-up kit (Zymo research, Irvine, CA, USA) according to manufactures instructions.

Genomic DNA was extracted by a conventional method using a DNA extraction kit (Lifefeng Biotech, Shanghai). The DNA sequence of the PHEX gene was obtained from an online database (GenBank accession No. NC_000012). All 22 exons with their adjacent intronic sequences of the PHEX gene were amplified by PCR with 21 pairs of sequencing primers designed using Primer 3 software. The primers were presented in Table 1. Direct DNA sequencing was performed using a BigDye Terminator Cycle Sequencing Ready Reaction Kit, version 3.1 (Applied Biosystems, Foster, CA, United States), and then analyzed with an automated ABI 3730 sequencer (Foster, CA, United States). Single-nucleotide polymorphisms (SNPs) were identified using Polyphred2, and novel mutations were identified using HGMD (23 (link)). Polyphen-2 (http://genetics.bwh.Havard.edu/pph2/), PROVEAN (http://provean.jcvi.org/index.php), and Mutation Taster (http://www.mutationtaster.org/) were used to predict the pathogenicity of missense mutations in the PHEX gene. For Polyphen-2 analysis, the following three empirically derived outcomes were used: most likely damaging, possibly damaging, and benign. For PROVEAN, scores ≤−2.5 are predicted to be deleterious. For Mutation Taster, the possibility of a mutation being a disease-causing mutation is scaled from 0 (low) to 1 (high).

Genomic DNA was extracted from peripheral blood leukocytes using a DNA extraction kit (Lifefeng Biotech, Shanghai). The DNA sequence for the PHEX gene was obtained from an online database (GenBank accession NO. NC _000012.). The PCR and sequencing primers were the same as those used in our previous study and were designed using Primer 3 software¹. All 22 exons and exon-intron boundaries of the PHEX gene were amplified by polymerase chain reaction (PCR). Direct sequencing was performed using BigDye Terminator Cycle Sequencing Ready Reaction Kit, version 3.1 (Applied Biosystems, Foster, CA, United States), and the product was analyzed with an automated ABI 3730 sequencer (Foster, CA, United States). Single-nucleotide polymorphisms (SNPs) were identified using Polyphred² and novel mutations using HGMD.

The genomic DNA was extracted by the standard phenol–chloroform protocol from peripheral blood samples obtained from patients and their relatives. The exons and exon–intron boundaries were amplified by polymerase chain reaction (PCR) using primers designed by us (see Additional file 1). PCRs were performed in the presence of 50 ng of genomic DNA, 1× KCl buffer, 0.15 U Taq Polymerase, 200 μM each deoxynucleotide triphosphate (dNTP, Thermo Scientific), 0.5 pmol each primer and water to final volume of 10 μL. The PCR products were visualized on 1.5 % agarose gels. The amplicons produced by PCR were purified and were submitted to the bidirectional direct sequencing using the BigDye Terminator Cycle Sequencing Ready Reaction Kit version 3.1 (Applied Biosystems, Foster City, CA, USA), and were analyzed with an ABI 3500 XL automatic sequencer (Applied Biosystems^®) using standard methods.
Sequencing data were analyzed through the CodonCodeAligner version 4.1.1 software and the mutations found were compared with online data banks (Ensembl, HGMD^®, NCBI, dbSNP and LOVD^®). The novel mutation was valued by online prediction mutation software (http://www.mutationtaster.org/). In addition, 100 alleles from 50 control individuals were investigated for the novel mutation.

For pathogenic gene analysis of affected individuals, genomic DNA was extracted and purified from peripheral blood leukocytes with QuickGene DNA whole blood kit L by Nucleic Acid Isolation System (QuickGene-610L; FUJI FILM, Tokyo, Japan), the exons and exon-intron boundaries of HPGD (NM_000860.5) were amplified through PCR. Direct sequencing was performed using the BigDye Terminator cycle sequencing ready reaction kit, version 3.1 (Applied Biosystems; Foster City, CA, USA), and the reaction was performed using an ABI Prism 3130 automated sequencer (Applied Biosystems). UniProt (http://beta.uniprot.org/), Poly Phen-2 (Polymorphism Phenotyping V2; http://genetics.bwh.harvard.edu/pph2/) and SIFT (Sorting Intolerant from Tolerant; http://sift.jcvi.org/) were used to predict the conservation and pathogenicity of missense mutations found in our patients.