Total RNA from HUVEC and PBMC was extracted by TRIzol reagent (Invitrogen, Carlsbad, CA). Oligonucleotides were designed using the Primer3 software (available at http://frodo.wi.mit.edu/ ) and synthesized by Invitrogen company. The primer sequences are as follows: human IL-6: 5′-TGACCCAACCACAAATGC-3′ 3′-CTGGCTCTGAAACAAAGGAT-5′; human klotho: 5′-TCAGGCAAGATAAACCAA-3′ 3′-TCTAACAAACGGGAACG-5′; human β-actin: 5′-GTGGACATCCGCAAAGAC-3′ 3′-AAAGGGTGTAACGCAACTAA-5′. qRT-PCR was used to detect target gene expression. Reverse transcription was performed by using Transcriptor First-Strand cDNA Synthesis kit (Roche, Germany) according to the manufacture's instruction. Real-time PCR amplification was performed using the ABI 7500 real-time PCR Detection System (Foster City, CA) with FastStart Universal SYBR Green Master mix (Roche, Germany). Cycling conditions were 95°C for 10 min followed by 40 repeats of 95°C for 15 s and 60°C for 1 min. The relative gene expression level was calculated through delta-delta Ct method and β-actin was used as the internal control. Experiments were repeated in triplicate.
Abi 7500 real time pcr detection system
Manufactured by Roche
The ABI 7500 Real-Time PCR Detection System is a lab equipment product designed for real-time polymerase chain reaction (PCR) analysis. It provides essential functionality for performing quantitative and qualitative real-time PCR experiments.
Automatically generated - may contain errors
Lab products found in correlation
Faststart universal sybr green master mix, by Roche (4 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Dnase 1, by Thermo Fisher Scientific (2 mentions)
Transcriptor first strand cdna synthesis kit, by Roche (1 mentions)
Rt qpcr kit, by Takara Bio (1 mentions)
Trizol reagent, by Merck Group (1 mentions)
Sybr green pcr master mix, by Roche (1 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Sds 2, by Thermo Fisher Scientific (1 mentions)
Transcriptor first stand cdna synthesis kit, by Roche (1 mentions)
Fast start universal sybr green mix, by Roche (1 mentions)
Revertaid reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Dneasy tissue kit, by Thermo Fisher Scientific (1 mentions)
6 protocols using abi 7500 real time pcr detection system
1
Quantitative RNA Expression Analysis in HUVEC and PBMC
2
Alveolar Bone RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the alveolar bone surrounding the upper region of the first molar using TRIzol reagent (Sigma-Aldrich; Merck KGaA). A RT-qPCR Kit (Takara Bio, Inc., Otsu, Japan) was used to reverse transcribe the RNA to complementary (c)DNA, according to the manufacturer's protocol, the conditions of reactions were: 30°C for 10 min, 42°C for 30 min, 99°C for 5 min and 4°C for 5 min. Relative mRNA levels of alkaline phosphatase (ALP), osteocalcin (OCN), OPG and RANKL were determined using a SYBR Green PCR Master mix and an ABI 7500 Real-Time PCR Detection System (Roche Diagnostics, Basel, Switzerland). Primer sequences are listed in Table I . The conditions of reactions were: Initial denaturation at 94°C for 3 min and followed by 35 cycles of denaturation at 95°C for 10 sec, and annealing at 57°C for 30 sec. Reactions were run in triplicate and mean-averaged the results. Relative fold changes were calculated using the method of 2−ΔΔCq (22 (link)). GAPDH was used as the housekeeping gene.
3
Quantitative Real-Time PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After treating with DNase I (Thermo, USA) to remove residual genomic DNA, 2 μg of total RNA was converted to the first-strand cDNA by use of SuperScript III reverse-transcriptase (Invitrogen, USA). The cDNA products were then diluted in 100-folds with deionized water prior to PCRs. The qRT-PCR reaction was performed on an ABI 7500 Real-Time PCR Detection System using a FastStart Universal SYBR Green Master Mix (Roche). The thermal cycling conditions were as follows: 95°C for 10 min for one cycle; at 95°C for 15 s, then at 60°C for 1 min for 40 cycles. Three independent biological replicates were performed for each sample. The relative mRNA levels were normalized with respect to inner control genes (actin) and expressed relative to the corresponding values of leaf (control), which were given an arbitrary value of 1. Primer pairs were designed using Primer 5 software, and the primer sequences were available on-line (S8 Table ).
4
Measuring Podocyte mtDNA and Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cultured podocytes and isolated glomeruli was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA). Oligonucleotides were designed using Primer3 software (available at http://frodo.wi.mit.edu/ ) and synthesized by Invitrogen. qRT-PCR was used to detect the mtDNA copy number and the target gene expression. Reverse transcription was performed by using a Transcriptor First Stand cDNA Synthesis kit (Roche, Germany) according to the manufacturer's protocol. Real-time PCR amplification was performed using an ABI 7500 Real-time PCR Detection System (Foster City, CA) with FastStart Universal SYBR Green master mix (Roche, Germany). The cycling conditions were 95°C for 10 min followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. The relative mtDNA copy numbers were normalized to the 18S ribosomal RNA levels encoded by the nuclear DNA, and CT values were used to analyze the mRNA levels based on a standard curve using SDS 2.2.2 software (Applied Biosystems).
5
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using Trizol reagent according to the manufacturer’s instructions. First strand cDNA was synthesized using RevertAid Reverse Transcriptase (Thermo Scientific, Wilmington, DE, USA) with 1.5 μg of the total RNA as the template. The gene-specific primers used to amplify the gene transcripts are shown in Supplementary Table 1 . The X. strumarium actin 2 gene (GenBank accession no. JF434698) was used as an internal standard to normalize the variation in cDNA preparations. The qRT-PCRs were performed with an ABI 7500 Real-Time PCR Detection System using a FastStart Universal SYBR Green Mix (Roche) in three independent biological replicates with three technical repeats. The thermal cycling parameters were set as follows: one cycle at 95°C for 15 min, followed by 40 cycles at 95°C for 15 s and then 60°C for 1 min. For a given gene, the relative gene expression level was normalized with respect to the internal control X. strumarium actin 2 gene, and calculated using the 2-ΔΔCt method (Livak and Schmittgen, 2001 (link)).
6
Quantifying Mitochondrial DNA in Renal Cortex
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total DNA from renal cortex was isolated using a DNeasy Tissue Kit (Invitrogen). The target gene and reference gene were detected with real-time PCR. Amplification was performed using an ABI 7500 real-time PCR Detection System (Foster City, CA) with FastStart Universal SYBR Green master mix (Roche, Germany). Thermal cycling conditions were 95°C for 10 min followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. Primer 3 software was used to design the primers (http://Frodo.wi.mit.edu ). Relative amounts of mtDNA copy numbers were normalized to the nuclear 18S rRNA. The primer pair sequences are shown as follows: mtDNA, Forward: 5′TTTTATCTGCATCTGAGTTTAATCCTGT3′, Reverse: 5′CCACTTCATCTTACCATTTATTATCGC3′; 18SrRNA, Forward: 5′GGACCTGGAACTGGCAACAT3′, Reverse: 5′GCCCTGAACTCTTTTGTGAAG3′.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!