Superscript preamplification system for first strand cdna synthesis

Manufactured by Thermo Fisher Scientific

Sourced in United States

The SuperScript Preamplification System is a first-strand cDNA synthesis kit designed for use with low-input RNA samples. The system provides a reliable and efficient method for converting RNA into cDNA, which can then be used for downstream applications such as PCR or gene expression analysis.

Automatically generated - may contain errors

Lab products found in correlation

Isogen reagent, by Nippon Gene (1 mentions) Icycler, by Bio-Rad (1 mentions)

Close spelling variants of this product

First-Strand cDNA Synthesis System First-Strand Synthesis System SuperScript Preamplification System CDNA synthesis system

2 protocols using superscript preamplification system for first strand cdna synthesis

Genetic Analyses of SMARCB1 and CNTNAP2

Check if the same lab product or an alternative is used in the 5 most similar protocols

Direct sequencing analyses of all coding exons of SMARCB1 and CNTNAP2 were carried out in all samples as previously described.14 (link) The primer sequences and conditions of PCR for mutation analyses of these genes have been described in previous papers.14 (link),15 (link) Total RNA was extracted from the nine cell lines using Isogen reagent (Nippon Gene, Osaka, Japan), according to the manufacturer's instructions and subjected to RT-PCR to synthesize cDNA using the SuperScript Preamplification System for first-strand cDNA synthesis (Life Technologies, Rockville, MD, USA). Semiquantitative RT-PCR analysis for CNTNAP2 expression was carried out as previously described.16 (link)

Takita J., Chen Y., Kato M., Ohki K., Sato Y., Ohta S., Sugita K., Nishimura R., Hoshino N., Seki M., Sanada M., Oka A., Hayashi Y, & Ogawa S. (2014). Genome-wide approach to identify second gene targets for malignant rhabdoid tumors using high-density oligonucleotide microarrays. Cancer Science, 105(3), 258-264.

+ Open protocol

+ Expand

Quantifying Drosophila Circadian Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

cDNA synthesis and real-time RT-PCR reactions were performed as described in detail previously [27 (link)]. The cDNAs were synthesized from total RNA extracted from the 15 pooled third instar larval hearts using SUPERSCRIPT Pre-amplification System for First-Strand cDNA Synthesis (Life Technologies). The expressions of dCry or the house-keeping gene dActin5c were quantified using real-time RT-PCR with dCry or dActin5c-specific sense and antisense primers on an iCycler (BIO-RAD). The sequences of primers are: dCry5’ GCACACGGTGCAAATTATTG, 3’ GAAGCCCATGTTGTCTCCAT; RT-PCR product size 166bp; dActin5C5’ TACCCCATTGAGCACGGTAT, 3’ GGTCATCTTCTCACGGTTGG; RT-PCR product size 166bp. The relative numbers of copies (%) of mRNA molecules of the expressions of dCry were shown after calibrated by co-amplification of dActin5c.

Alex A., Li A., Zeng X., Tate R.E., McKee M.L., Capen D.E., Zhang Z., Tanzi R.E, & Zhou C. (2015). A Circadian Clock Gene, Cry, Affects Heart Morphogenesis and Function in Drosophila as Revealed by Optical Coherence Microscopy. PLoS ONE, 10(9), e0137236.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!