Endophilin-A1-BAR (residues 1–256 of mouse endophilin-A1) was expressed and purified as described (Weissenhorn, 2005 (link)). Briefly, endophilin-A1-BAR was expressed in E. coli cells BL21 codon plus™ (Invitrogen). The bacterial cell lysate was applied onto Ni-chelating sepharose (GE Healthcare),washed extensively with buffer A (50 mM Tris-HCl pH 8, 0.3 M NaCl) supplemented with 1 M NaCl, followed by a buffer A wash supplemented with 1 M KCl to remove nucleic acids. In order to remove lipids potentially associated with endophilin the column was washed with buffer A supplemented with 1% CHAPS. Finally any non-specific contaminants were removed with a buffer A wash supplemented with 0.1 M imidazole. The protein was eluted with 0.3 M imidazole in buffer A. A final gel filtration was performed on a Superdex 200 column (GE Healthcare) in buffer B (20 mM Bicine pH 9, 100 mM NaCl).
Ni chelating sepharose
Manufactured by GE Healthcare
Ni-chelating Sepharose is a pre-packed chromatography medium designed for the purification of histidine-tagged recombinant proteins. It utilizes the selective interaction between nickel ions and the histidine tag to capture and isolate the target protein from complex mixtures.
Automatically generated - may contain errors
6 protocols using ni chelating sepharose
1
Endophilin-A1-BAR Protein Purification
2
Recombinant Protein Expression and Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The protein was expressed in E. coli strain BL21 (DE3) pLysS cells (Novagen). Cells were grown in LB medium (supplemented with the appropriate antibiotic, 0.5% sucrose, 0.5% glycerol, 1 mM magnesium chloride, 50 mM Na2HPO4, 50 mM KH2PO4, and 25 mM (NH4)2SO4) at 30°C to an OD600 of 1.2. Expression was induced by incubation for a further 16 h with 0.1 mM isopropyl β-D-1-thiogalactopyranoside at 18°C. The protein was purified by a combination of affinity and ion exchange chromatographic steps. Cells were resuspended in 50 mM Tris-HCl (pH 8.0), 500 mM NaCl, 1 mM PMSF, 0.2% Triton X-100, and 0.1% Tween 20, sonicated on ice, and centrifuged at 15,000 × g for 40 min. Clarified lysate was treated with 0.05% polyethyleneimine for 30 min at 4°C, the resulting suspension was centrifuged at 15,000 × g for 40 min, and the pellet was discarded. Supernatant was bound to Ni-chelating Sepharose (GE Healthcare). The resin was washed extensively with 50 mM Tris-HCl (pH 8.0), 500 mM NaCl, 0.05% and Igepal CA-630, and the bound protein was eluted in 50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 0.3 M imidazole, and 10% glycerol. The protein was further bound to SP Sepharose (GE Healthcare) in 50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 0.01% Triton X-100, and 2 mM DTT, eluting with a linear gradient of 150 mM to 1 M NaCl. The glycerol was added to 50% and protein stored at −20°C.
3
Recombinant dSaCas9-p300 Protein Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The protein was produced in E. coli strain BL21 (DE3) pLysS cells (Novagen). Cells were grown in LB medium supplemented with the appropriate antibiotic, 0.5% sucrose, 0.5% glycerol, 1 mM magnesium chloride, 50 mM di-sodium hydrogen phosphate, 50 mM potassium dihydrogen phosphate, and 25 mM ammonium sulfate, and grown at 30°C to OD600 of 1.2. Protein expression was induced by incubation with 0.1 mM IPTG for 16 h at 18°C. dSaCas9-p300 protein was purified by a combination of affinity and ion-exchange chromatography steps. Cells were resuspended in 50 mM Tris/HCl (pH 8.0), 500 mM NaCl, 1 mM PMSF, 0.2% Triton X-100, and 0.1% Tween 20, sonicated on ice, and centrifuged at 15,000 × g for 40 min. The lysate was treated with 0.05% polyetheleneimine for 30 min at 4°C; the resulting suspension was centrifuged at 15,000 × g for 40 min. Supernatant was bound to Ni-Chelating Sepharose (GE Healthcare). The resin was washed extensively with 50 mM Tris/HCl (pH 8.0), 500 mM NaCl, and 0.05% Igepal CA-630, and bound protein was eluted in 50 mM Tris/HCl (pH 8.0), 150 mM NaCl, 0.3 M imidazole, and 10% glycerol. The protein was further bound to SP Sepharose (GE Healthcare) in 50 mM Tris/HCl (pH 7.5), 150 mM NaCl, 0.01% Triton X-100, and 2 mM DTT, and eluted with a linear gradient of 150 mM to 1 M NaCl. Glycerol was added to the final concentration of 50%; protein was stored at −20°C.
4
Affinity Purification of GST and His-tagged Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
GST or GST-hARTC1 (N23–C295) and His-hARTC3 (N27–C362) were incubated with Glutathione Sepharose 4B beads (GE Healthcare, 17-5132-02) and Ni-chelating Sepharose (GE Healthcare, 17-0575-02), respectively, at 4°C for 2 h with rotation. After washing three times with NETN 100 buffer, the samples were boiled in SDS loading buffer and analyzed by 10% SDS–PAGE followed by western blotting using anti-His and anti-GST antibodies.
5
Recombinant Protein Expression and Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
hARTC1 and hARTC3 were cloned into the SFB vector (SFB tag; see Supplementary Figure S8 for detailed vector construction methods) or phage-HA vector (HA tag), respectively. hARTC1-N23–C295, hARTC3-N27–C362, hARTC4-N47–C285, and hARTC5-N23–C291 were cloned into the pGEX-4T-1 vector with an N-terminal GST for purification of recombinant proteins GST-ARTC1 (N23–C295), GST-ARTC3 (N27–C362), GST-ARTC4 (N47–C285), and GST-ARTC5 (N23–C291). hARTC3-N27–C362 was also cloned into the pET-15b vector with an N-terminal His tag. Human full-length VAPB and the R50K mutant were cloned into the SFB vector. Human full-length SCRN1 was cloned into the phage-HA vector.
Recombinant proteins were expressed as GST or His fusions in the respective vectors in E. coli BL21 (Codon Plus) at 37°C. Protein expression was induced by adding 0.12 mM IPTG at 22°C for 16 h. Subsequently, the cells were lysed by sonication in ice-cold lysis buffer (25 mM Tris–HCl, pH 8.0, 400 mM NaCl, and 5% glycerol). After centrifugation, the supernatant containing recombinant proteins were loaded onto Glutathione Sepharose 4B beads (GE Healthcare, 17-5132-02) or Ni-chelating Sepharose (GE Healthcare, 17-0575-02) pre-equilibrated with lysis buffer. All bound proteins were eluted using elution buffer (25 mM Tris–HCl, pH 8.0, 400 mM NaCl, 5% glycerol, and 250 mM imidazole).
Recombinant proteins were expressed as GST or His fusions in the respective vectors in E. coli BL21 (Codon Plus) at 37°C. Protein expression was induced by adding 0.12 mM IPTG at 22°C for 16 h. Subsequently, the cells were lysed by sonication in ice-cold lysis buffer (25 mM Tris–HCl, pH 8.0, 400 mM NaCl, and 5% glycerol). After centrifugation, the supernatant containing recombinant proteins were loaded onto Glutathione Sepharose 4B beads (GE Healthcare, 17-5132-02) or Ni-chelating Sepharose (GE Healthcare, 17-0575-02) pre-equilibrated with lysis buffer. All bound proteins were eluted using elution buffer (25 mM Tris–HCl, pH 8.0, 400 mM NaCl, 5% glycerol, and 250 mM imidazole).
6
Recombinant Hemojuvelin Protein Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sequence alignment indicated the human HFE2 gene (NCBI accession number: NG_011568.1), the canine HFE2 gene (NCBI accession number: XP_022260651), and feline HFE2 gene (NCBI accession number: XP_023114851) showed high sequence homology. Hence, the human HFE2 gene was selected for expression of recombinant protein because of the known stability of this protein. The sequences of primers used for amplification were forward: 5′‐TTCATATGCAGGAATGCATTGACCAG and reverse: 5′‐TTCTCGAGCTGAATGCAAAGCCACAGAAC. The amplified gene then was cloned into the vector pET24 (Novagen) for expression in Escherichia coli. After induction with 0.8 mM of isopropyl thiogalactoside (IPTG), the recombinant hemojuvelin was purified by chromatography using Ni‐chelating sepharose (GE Healthcare). The purified recombinant hemojuvelin protein was used to immunize rabbits and rats to generate rabbit‐origin and rat‐origin antihemojuvelin polyclonal antibodies (Abs); Ab production was carried out by a biotechnology company (Yoa‐Hong Biotechnology Inc, Taiwan).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!