The largest database of trusted experimental protocols

Ni nta affinity chromatography resin

Manufactured by Qiagen
Sourced in Switzerland

Ni-NTA affinity chromatography resin is a solid support material used in protein purification. It consists of nickel-nitrilotriacetic acid (Ni-NTA) coupled to an agarose matrix. The Ni-NTA group binds to proteins containing a polyhistidine (His-tag) sequence, allowing for selective capture and purification of the tagged proteins from complex mixtures.

Automatically generated - may contain errors

5 protocols using ni nta affinity chromatography resin

1

Cloning and Purification of FnBPA-A Protein

Check if the same lab product or an alternative is used in the 5 most similar protocols
The gene encoding of the FnBPA‐A protein was amplified from the genomic DNA of S. aureus strain WWGSP‐30 by PCR using specific primers (F: 5′‐CGCGGATCCGTGAAAAACAATCTTAGGTACGGC‐3′,R:5′‐CCGCTCGAGTTAAGCTGTGTGGTAATCAATGTCAAG‐3′, underlined for BamH I and Xho I restriction sites). Then, the PCR products were cloned into the BamH I and Xho I sites of the pET‐32a(+) vector to construct the recombinant plasmid pET‐32a‐FnBPA‐A. The recombinant plasmid was verified by enzyme digestion and sequencing and then transformed into E. coli strain BL21 (DE3) competence cells.
The recombinant plasmid pET‐32a‐FnBPA‐A and the control plasmid pET‐32a were induced with 0.3 mmol/L isopropyl‐β‐D‐thiogalactopyranoside (IPTG, Sigma) for 5.5 hr at 30°C. The soluble recombinant FnBPA‐A protein (rFnBPA‐A) was collected and purified with nickel‐nitrilotriacetic acid (Ni‐NTA) resin affinity chromatography (Qiagen) according to the manufacturer's instructions. The purity, concentration, and immunoreactivity of the purified protein were analyzed by 13% SDS‐PAGE, BCA Protein Assay Kit (Kang Wei, China) and western blot, respectively.
+ Open protocol
+ Expand
2

CpxR Protein Purification and EMSA

Check if the same lab product or an alternative is used in the 5 most similar protocols
The His6-CpxR protein was expressed using E. coli BL21 (DE3)-containing pET30a-CpxR and purified by using a Ni-nitrilotriacetic acid (Ni-NTA) resin affinity chromatography (Qiagen, Germany). The purified protein was phosphorylated by acetyl phosphate (Sigma, United States) according to previously described procedures (Li et al., 2018 (link)). DNA probes were amplified and purified and then labeled using a Biotin Labeling Kit (Beyotime, China). Then, the phosphorylated CpxR and labeled probes were used for protein-DNA EMSAs as described previously (Cheng et al., 2021 (link)). Labeled DNA probe (1 μM) and various concentrations of phosphorylated CpxR protein (0–4 pmol) were incubated at 24°C for 20 min in reaction buffer (50 mM Tris–HCl, pH 8.0, 2.5 mM MgCl2, 100 mM KCl, 0.2 mM DTT, 10% glycerol, 2 μg salmon sperm DNA). For competition experiments with unlabeled DNA probes, a 100-fold molar excess was preincubated with phosphorylated CpxR protein. The reaction mixtures were loaded on a 4% non-denaturing polyacrylamide electrophoresis in 0.5 × Tris-borate-EDTA (TBE) buffer. The bands of labeled probes were subsequently transferred to nylon membrane (Beyotime, China), and detected using the Chemiluminescent EMSA Kit (Beyotime, China).
+ Open protocol
+ Expand
3

Purification of Single Chain C1q Polypeptide

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 1

Expression of Single Chain C1q Fusion Polypeptide

The clarified supematants containing hexahis-tagged polypeptides were loaded on a Ni-NTA affinity chromatography resin (Qiagen, Hanbrechtikon, Switzerland) at 4° C. After wash steps each with 20 mM sodium phosphate buffer comprising 300 mM NaCl at pH 7.4 and containing 20 mM imidazole, polypeptides were eluted at a flow rate of 3 ml/min using batch elution with the same buffer containing 100 mM respectively 300 mM imidazole on an AKTA Explorer 100 chromatography system (GE Healthcare Life Sciences, Uppsala, Sweden). Fractions were pooled according to CE-SDS (LabChip GX, Caliper) under denaturing and reducing conditions, concentrated using Amicon Ultra-15 (Merck Millipore) and dialyzed against 50 mM sodium phosphate buffer containing 500 mM NaCl adjusted to pH 7.4. Purified polypeptides were quantified using a Nanodrop spectrophotometer (Nanodrop Technologies, Wilmington, Del.), analyzed by CE-SDS (LabChip GX, Caliper) and stored at −80° C.

+ Open protocol
+ Expand
4

Purification of PNDD Proteins from Bacteria

Check if the same lab product or an alternative is used in the 5 most similar protocols
Bacteria expressing PNDD0, PNDD1 or PNDD2 were resuspended in 3 mL of lysis buffer (Tris 50 mM pH 8, NaCl 170 mM, imidazole 20 mM, urea 6 M, NP40 0.5% v/v) for a pellet corresponding to 60 mL bacterial culture. The solution was homogenized and sonicated. Insoluble material was discarded by centrifugation for 30 min at 16,000 g at 4 °C. 2 ml of packed Ni–NTA affinity chromatography resin (Qiagen, USA) was calibrated with 10 volumes of lysis buffer, before being incubated with soluble PNDD0, PNDD1 or PNDD2 overnight on rotor at 4 °C. Resin was then washed with 10 volumes of washing buffer (Tris 50 mMpH 8, NaCl 170 mM, imidazole 40 mM, urea 6 M, NP40 0.5% v/v). PNDD0, PNDD1 or PNDD2 were eluted twice with 1 volume of elution buffer (Tris 50 mM pH 8, NaCl 170 mM, imidazole 1 M, urea 6 M, NP40 0.5% v/v). Purified protein elute was injected in Slide-A-lyzer Dialysis Cassette 20,000 MWCO (Thermo Scientific) and incubated in 3 baths of 100 volumes of PBS for 21 h at 4 °C. Dialysed elute is retrieved from the cassette and tested for solubility by spinning down for 30 min at 15,000 g 4 °C. The supernatant is retrieved and stored at -80 °C. The pellet is resuspended in the same volume with lysis, washing or elution buffer. A sample is taken from each fraction to compare the amount of purified protein.
+ Open protocol
+ Expand
5

FcRn Protein Purification Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 4

Purification of Human FcRn, Mouse FcRn and Cynomolgus FcRn

The clarified supernatants containing hexahis-tagged proteins were loaded on a Ni-NTA affinity chromatography resin (Qiagen, Harbrechtikon, Switzerland) at 4° C. After wash steps with 20 mM sodium phosphate buffer comprising 500 mM NaCl at pH 7.4 and containing 20 mM, respectively 100 mM imidazole, proteins were eluted at a flow rate of 2 ml/min using batch elution with the same buffer containing 300 mM imidazole on an ÄKTA Prime chromatography system (Amersham Pharmacia Biotech, Uppsala, Sweden). Fractions were pooled and further purified in sodium phosphate buffer containing 500 mM NaCl on size exclusion chromatography (Superdex™ 200, GE Healthcare, Zurich, Switzerland). Purified proteins were quantified using a Nanodrop spectrophotometer (Nanodrop Technologies, Wilmington, Del.) and analyzed by SDS PAGE on NuPAGE 4-12% Bis-Tris gels in MES buffer under denaturing and reducing conditions.

+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!