Medium molecular weight chitosan with 77% deacetylation (MW = 190–310 kDa), glutaraldehyde solution (50%), ethanol (EtOH, 99.5%), sodium hydroxide (NaOH), phosphate buffered saline (PBS), glycine and hydrochloric acid (HCl, 37.0%) were obtained from Sigma Aldrich. Lithium fluoride (LiF, 99% trace metals basis) and trifluoroacetic acid (TFA, 99%) were obtained from Alfa Aesar. Sodium chloride (NaCl), BD Bacto™ Agar and yeast extract were purchased from Fisher Scientific and Tryptone from Oxoid. NEB® 5-alpha competent Escherichia coli was purchased from New England Biolabs and Staphylococcus aureus subsp. aureus Rosenbach was purchased from American Type Culture Collection (ATCC).
Neb 5 alpha competent escherichia coli
Manufactured by New England Biolabs
Sourced in United States
NEB 5-alpha–competent Escherichia coli is a laboratory strain of Escherichia coli bacteria that has been made competent for efficient DNA transformation. This product is suitable for applications that require the introduction of plasmid DNA into bacterial cells.
Automatically generated - may contain errors
Lab products found in correlation
Ez dna methylation kit, by Zymo Research (2 mentions)
Yeast extract, by Thermo Fisher Scientific (1 mentions)
Sodium chloride (nacl), by Thermo Fisher Scientific (1 mentions)
Tryptone, by Thermo Fisher Scientific (1 mentions)
Trifluoroacetic acid, by Thermo Fisher Scientific (1 mentions)
Glutaraldehyde solution, by Merck Group (1 mentions)
Medium molecular weight chitosan, by Merck Group (1 mentions)
Lithium fluoride, by Thermo Fisher Scientific (1 mentions)
Ethanol, by Merck Group (1 mentions)
Sodium hydroxide (naoh), by Merck Group (1 mentions)
Phosphate buffered saline (pbs), by Merck Group (1 mentions)
Hydrochloric acid (hcl), by Merck Group (1 mentions)
Glycine, by Merck Group (1 mentions)
Pgem t easy vector, by New England Biolabs (1 mentions)
Pcr2.1 topo vector, by Thermo Fisher Scientific (1 mentions)
Qiaprep spin miniprep kit, by Qiagen (1 mentions)
Isolate 2 pcr and gel kit, by Meridian Bioscience (1 mentions)
Trisure reagent, by Meridian Bioscience (1 mentions)
Q5 high fidelity dna polymerase, by New England Biolabs (1 mentions)
Sodium dodecyl sulfate polyacrylamide gel electrophoresis sds page, by Bio-Rad (1 mentions)
7 protocols using neb 5 alpha competent escherichia coli
1
Chitosan-Glutaraldehyde Antimicrobial Synthesis
2
Methylation Analysis of Genomic DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA isolated from white blood cells of disease-free individuals was obtained from the Van Andel Research Institute Pathology and Biorepository Core. For trio analysis, the following DNA samples were obtained from the National Human Genome Research Institute Sample Repository for Human Genetic Research at the Coriell Institute for Medical Research: HG00731, HG00732, HG00733, HG01938, HG01939, and HG01940. Bisulfite conversion and clean-up of 2 μg of genomic DNA was performed by using the EZ DNA Methylation Kit (Zymo Research) according to the manufacturer’s protocol. Locus-specific PCR was performed by using primers specific for bisulfite-converted DNA and PCR products cloned by using the pGEM-T Easy vector and NEB 5-alpha–competent Escherichia coli (New England Biolabs). Colonies were screened for positive inserts by PCR and sequencing performed using the M13 promoter.
3
DNA Methylation Analysis via TOPO Cloning
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bisulfite treated first-step PCR products purified from agarose gel were used as templates for a TOPO TA cloning reaction using the pCR 2.1TOPO vector (Invitrogen, Carlsbad, CA). ODC + and liver first-step MOG products were used as the mouse demethylated and methylated inserts, respectively. Human demethylated and methylated DNA (Zymo Research, Irvine, CA) first-step MOG products were used for the human demethylated and methylated inserts, respectively. NEB 5-alpha competent Escherichiacoli (New England Biolabs, Ipswich, MA) were used for transformation with the TOPO MOG products and incubated at 37 °C overnight on ImMedia Kan Agar plates (Invitrogen, Carlsbad, CA). Individual colonies were added to a culture of LB broth/Kanamycin (Gibco, Carlsbad, CA) and shaken at 37 °C overnight. The QIAprep Spin Miniprep Kit (Qiagen N.V., Valencia, CA) was used to purify the TOPO plasmid from the cultures.
4
Cloning and Sequencing of Sea Bass Spexin 1 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The putative sea bass spexin 1 (spx1) gene sequence was identified through TBLASTN search in the genome of this species using the orange‐spotted grouper Spx1 (AML84198) as the query. Gene‐specific primers (Table 1 ) were designed, and cloning was performed as described previously (Paullada‐Salmerón et al., 2016 (link)). Briefly, total RNA from the whole brain was isolated using the TRIsure™ reagent (Bioline, London, UK), and 5 µg of total RNA were used as a template for the first‐strand cDNA synthesis using the iScript™ Advanced cDNA Synthesis Kit for quantitative Real‐Time Polymerase Chain Reaction (RT‐qPCR) (Bio‐Rad, Richmond, CA) according to the manufacturer's instructions. PCR amplification was performed using the Q5® High‐Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA), and thermo cycling conditions were as follows: denaturation at 98°C for 30 s, followed by 40 cycles of 98°C for 10 s, 56°C for 20 s, and 72°C for 30 s and a final incubation for 10 min at 72°C. PCR fragments of the expected size were extracted, purified with ISOLATE II PCR and Gel Kit (Bioline) and subcloned into the pSpark® II Blunt DNA cloning vector (Canvax Biotech, Córdoba, Spain). The vectors containing the amplified fragment were transformed into NEB® 5‐alpha Competent Escherichia coli (New England Biolabs) from which five positive clones were obtained and sequenced.
5
MERS-CoV S Glycoprotein Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
An expression construct encoding amino acids 358-571 (VEQA…CPKL) of the MERS S glycoprotein and a carboxy terminal 6x HIS tag was synthesized by Twist Biosciences and cloned into the pTwist CMV BetaGlobin WPRE Neo expression vector. Plasmids were produced in NEB 5-alpha competent Escherichia coli (New England Biolabs, Ipswich, MA, USA) and transfected into Expi293 cells using the Expi293 Expression System Kit (Thermo Fisher, Waltham, MA, USA) according to the manufacturer’s instructions. Seven days following transfection, cleared supernatants were passed over a HisTrap HP column (Cytiva), and bound protein was eluted with 450 mM imidazole. Buffer exchange to PBS and protein concentration was performed using centrifugal protein concentrators with a 10 kDa MW cutoff (Pierce, Appleton, WI, USA). Final protein concentration was determined by BCA protein assay (Pierce). MW and protein purity were confirmed by Sodium dodecyl-sulfate polyacrylamide gel electrophoresis (SDS-PAGE) (Bio-Rad, Hercules, CA, USA) (Figure 2 ).
6
Bisulfite Sequencing of nc886 Locus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated from cancer cell lines using the DNeasy Blood and Tissue Kit (69504, Qiagen). Bisulfite conversion and clean-up of 200 ng of genomic DNA was performed by using the EZ DNA Methylation Kit (D5002, Zymo Research) according to the manufacturer’s protocol. Locus-specific PCR was performed by using primers specific for bisulfite-converted DNA and PCR products cloned using the pGEM-T Vector System (A3600, Promega) and NEB 5-alpha–competent Escherichia coli (C2987I, New England Biolabs). Colonies were screened for positive inserts by PCR and sequencing performed using the M13 promoter. Primers for nc886: F, tagtaaagttaaaagggataaaaaataata; R, acctcccctccaataaataaatttt.
7
CRISPR/Cas9 Knockout of Zeb1, Hdac2, and eNOS in mESCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To knock-out Zeb1, Hdac2, and eNOS the target-specific sgRNAs, listed in Supplementary Table 7 , were cloned into LentiCRISPR2 vector (addgene, Cambridge, MA) using the GoldenGate protocol70 (link).
All CRISPR/Cas9 experiments were compared to non-targeting control (NTC) obtained with the sgRNAs, listed in Supplementary Table7 , cloned into the LentiCRISPR2 vector using the GoldenGate protocol.
The obtained plasmids were transformed into NEB 5-alpha Competent Escherichia coli (High Efficiency –New England Biolabs), then DNA was purified by EZNA Fastfilter Endo-Free Plasmid DNA Maxi Kit (Omega Bio-Tek), and a concentration of 6 μg was used for nucleofection. Nucleofection was performed in 106 mESC cultured in GS using Amaxa P3 primary cell 4D Nucleofector Kit (Lonza). After 48 h, nucleofected mESC were selected by 1.5 μg mL−1 puromycin. After recovery from selection, mESC were tested for Zeb1, Hdac2, and eNOS knockout by western blot. mESC nucleofected with eNOS CRISPR/Cas9 vectors resulted knocked out and were used for subsequent experiments, whereas mESC nucleofected either with Zeb1 CRISPR/Cas9 vectors or Hdac2 CRISPR/Cas9 vectors were clonally expanded. Once monoclonal Zeb1_1 and Zeb1_2 CRISPR/Cas9 mESC as well as monoclonal Hdac2_1 and Hdac2_2_CRISPR/Cas9 mESC were obtained, expression analysis of mesendodermal markers was conducted.
All CRISPR/Cas9 experiments were compared to non-targeting control (NTC) obtained with the sgRNAs, listed in Supplementary Table
The obtained plasmids were transformed into NEB 5-alpha Competent Escherichia coli (High Efficiency –New England Biolabs), then DNA was purified by EZNA Fastfilter Endo-Free Plasmid DNA Maxi Kit (Omega Bio-Tek), and a concentration of 6 μg was used for nucleofection. Nucleofection was performed in 106 mESC cultured in GS using Amaxa P3 primary cell 4D Nucleofector Kit (Lonza). After 48 h, nucleofected mESC were selected by 1.5 μg mL−1 puromycin. After recovery from selection, mESC were tested for Zeb1, Hdac2, and eNOS knockout by western blot. mESC nucleofected with eNOS CRISPR/Cas9 vectors resulted knocked out and were used for subsequent experiments, whereas mESC nucleofected either with Zeb1 CRISPR/Cas9 vectors or Hdac2 CRISPR/Cas9 vectors were clonally expanded. Once monoclonal Zeb1_1 and Zeb1_2 CRISPR/Cas9 mESC as well as monoclonal Hdac2_1 and Hdac2_2_CRISPR/Cas9 mESC were obtained, expression analysis of mesendodermal markers was conducted.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!